5% dimethyl sulphoxide (DMSO) just prior to carrying out the assays. Biofilm preparation and treatments Biofilms of S. mutans UA159 were formed on saliva-coated hydroxyapatite (sHA) discs (surface area of 2.93 ± 0.2 cm2, Clarkson Chromatography Products Inc., South Williamsport, PA, USA) in batch cultures for 5 days, as detailed elsewhere [21]. The biofilms were grown in ultrafiltered (10 kDa molecular-weight cut-off) buffered tryptone yeast-extract broth containing 1% (w/v) sucrose [21]. The culture medium was replaced daily; the organisms were grown undisturbed for 22 h to allow initial biofilm formation. At this point (22 h old), the biofilms were then treated twice-daily (at 10 a.m. and 4 p.m.) until the end of

PLX-4720 the experimental period (118-h-old biofilm) with one of the following: (i) 1.0 mM myricetin + 2.5 mM tt-farnesol + 125 ppm fluoride (MFar125F); (ii) 1.0 mM myricetin + 2.5 mM tt-farnesol + 250

ppm fluoride (MFar250F); (iii) 250 ppm fluoride (250F); (iv) vehicle control (20% ethanol containing 2.5% DMSO in water); fluoride Roscovitine at 125 ppm F was not included because it is devoid of any significant anti-biofilm effects [12, 13]. The biofilms were exposed to the treatments for 1 min., dip-rinsed three times in sterile saline solution (to remove excess of agents or vehicle-control) and transferred to culture medium. The treatments and rinsing procedures were repeated 6 h later. The pH of culture medium surrounding the biofilms was also determined during the experimental period (until 118 hour biofilms, at 8 a.m., 12 a.m., 4 p.m., 6 p.m.). Our previous 3-mercaptopyruvate sulfurtransferase studies have shown that the vehicle control (1 min exposure, twice daily) allowed the continued formation of biofilm, and did not affect the biochemical composition and cell viability when compared to biofilms treated with saline solution [20, 21]. Each biofilm was exposed to the respective treatment a total of 8 times. Biofilm assays were performed in duplicate in at least six different experiments. RNA extraction and real-time RT-PCR At selected time points (49- and 97-h-old biofilms), RNA was extracted and purified using standard protocols optimized for biofilms [22]; RNA integrity number

(RIN) for our samples was ≥ 9.0 as determined by lab on-chip capillary electrophoresis [22]. The reverse transcriptase PCR, real-time qPCR amplification conditions, and the gene-specific primers (for gtfB, gtfC and gtfD) were similar to those described previously [14]. Specific genes related to acid tolerance mechanisms, aguD (part of the agmatine deiminase system operon) and atpD (part of the F-ATPase operon) were also tested. The aguD (5- ATCCCGTGAGTGATAGTATTTG -3 and 5-CAAGCCACCAACAAGTAAGG-3) and atpD (5-CGTGCTCTCTCGCCTGAAATAG-3 and 5-ACTCACGATAACGCTGCAAGAC-3) specific primers were designed using Beacon Designer 2.0 software (Premier Biosoft International, Palo Alto, CA, USA). Briefly, cDNAs were synthesized using BioRad iScript cDNA synthesis kit (Bio-Rad Laboratories, Inc., CA).