coli. The resulting plasmid (pCG132) was verified by sequencing and electroporated into S. aureus strain RN4220. Since pMUTIN4 does not have a gram-positive origin of replication,

all clones had gone through a single crossover event, which inserted the vector into the genome and placed the cap5A gene under the control of the IPTG-inducible Pspac promoter. The integrated plasmid was then transduced into strain Newman using Φ11 lysates. Mutants were verified by PCR using the oligonucleotides P5spac (TACATCCAGAACAACCTCTG) and capArev (GACTTTAACTGCTGTACCGTCTGCT) and PFGE. Extraction of capsular polysaccharides (CP) For extraction of crude capsule extract, staphylococci were plated onto Columbia blood agar plates that had been supplemented

with 50 mM NaCl. After 24 h of incubation at 37°C, the bacteria were harvested by suspension in PBS buffer. The CP was detached from the cells by autoclaving at 120°C for 1 h and the cell debris LCZ696 concentration was removed by centrifugation. The supernatant was passed through JNK-IN-8 price a cellulose acetate filter (pore size 0.45 μm). Cell wall teichoic acid was removed by treatment with 50 mM NaIO4 for 72 h at room temperature in the dark [39]. The crude extract was then washed with PBS buffer by ultrafiltration on a YM10 membrane (Millipore, Schwalbach, Germany) or employing Vivaspin 6 columns (exclusion volume of 3 kDa) (Sartorius, Göttingen Germany). These extracts were then added to MIC determinations in MH medium using S. aureus NCTC 8325 and S. aureus SG511 as indicator strains. In order to test for contaminating nucleic acids, the extracts were digested with DNase and RNAse [40] and tested again. Crude capsule extract from S. aureus NCTC 8325 which cannot produce a capsule because of the point mutation in Cap5E and PBS buffer served as negative controls in these experiments. Purified CP5 was obtained as described in [41]. Sequencing of the promoter region of the CP5 biosynthesis gene cluster A 735 bp DNA segment comprising the promoter region

of the CP5 biosynthesis gene cluster was amplified using a standard PCR protocol and the primer pair (AGCTCGCATTTGAAGATCAATGT) and (CCTCTTGTGCCATAAACTGAGG) (bp 166966–166988 and bp 167586–167607, NCBI: NC_002745). The product was purified (QIAquick Gel Extraction Protein tyrosine phosphatase Kit, Qiagen, Hilden, Germany) and sequenced (Sequiserve, Vaterstetten, Germany). Detection of the cap5 gene cluster in the VISA strains was performed using primers cap5-9864 (GTACGAAGCGTTTTGATAGTT) and cap5-9332 (GAAAGTGAACGATTAGTAGAA) that flank the type-specific sequences of cap5I and cap5J in S. aureus [42]. The insertion of IS256 in cap5A in S. aureus SA1450/94 was complemented by reconstituting cap5A on the plasmid pCapAre, exactly as described in [34]. The fragment was amplified employing genomic DNA of S. aureus SA137/93G as a template and the primers pCapAreconfor (GCAGAGCTCGCATTTGAA) and pCapAreconrev (CCAATGATTAAGCTTGATAGTCC).