fumigatus β-tubulin F TGACGGGTGATTGGGATCTC 198 bp     R CGTCCGCTTCTTCCTTGTTT     Rodlet A F ACATTGACGAGGGCATCCTT 313 bp     R ATGAGGGAACCGCTCTGATG   Figure 1 Electrophoretic profile of several species of section

Fumigati. F1 – Aspergillus fumigatiaffinis, F2 – Aspergillus lentulus, F3 – Aspergillus novofumigatus, F4 – Aspergillus unilateralis, F5 – Neosartorya hiratsukae, F6 – Neosartorya pseudofischeri, F7 – Neosartorya udagawae; AF1, AF2 and AF3 – Aspergillus fumigatus see more strains. Rapid identification of Aspergillus fumigatus Multiplex PCR was successfully conducted in all fungal Epoxomicin strains included in the study. The specificity of the primers at 69°C was confirmed by the results obtained with singleplex PCR and amplification of each gene fragment in A. fumigatus: partial sequences of 153 and 198 bp for βtub, and 105 and 313 bp for rodA. The electrophoretic profile with MK-2206 order four bands (105, 153, 198 and 313 bp) was similar in all 35 tested strains of A. fumigatus. Non-fumigatus isolates of section Fumigati,

specifically A. fumigatiaffinis, A. lentulus, A. novofumigatus, A. unilateralis, N. hiratsukae, and N. pseudofischeri, produced two discrete bands (105 and 153 bp) corresponding to the conserved region of the section Fumigati for which the primers were designed (as showed in Figure 1). Neosartorya udagawae was an exception and formed a third band (with 313 bp) in a location that was similar to the amplification of A. fumigatus.

Carnitine dehydrogenase Amplicon sizes were confirmed using automated electrophoresis with the primers stained with 6-FAM. Therefore, the present multiplex PCR targeting βtub and rodA gene fragments resulted in a distinct band pattern in A. fumigatus compared to the band pattern obtained for the other species of section Fumigati. In addition, a clear differentiation of N. udagawae was also observed. The electrophoretic profile of the Aspergillus species of other taxonomic sections was distinct from the profile observed for A. fumigatus and was rarely similar to the profile obtained for species included in section Fumigati (two bands of 105 and 153 bp). Identification of species within the section Fumigati The polymorphisms found in the small gene fragments of βtub (153 bp) and rodA (103 bp) were compared among and between species of section Fumigati. A group of 425 partial sequences of βtub and rodA from fungal species of section Fumigati available at GenBank and EMBL-Bank were downloaded (annotation numbers are available as supplemental data; see additional file 1). A detailed alignment of βtub and rodA sequences of the species included in section Fumigati is available in Figures 2 and 3. The most relevant and exclusive polymorphic sites for each species within the section Fumigati were registered. The 153 bp region of βtub was able to differentiate 13 fungal species of section Fumigati (A. fumigatus, A. fumigatiaffinis, A. novofumigatus, N.