Moreover, the fact that Lmo2812 preferentially

Moreover, the fact that Lmo2812 preferentially STAT inhibitor degrades low-molecular-weight substrates may point to a role in cell wall turnover. The product of the tenth putative PBP gene, Lmo1855, was not found to bind β-lactams with any of the various methods employed and consequently cannot be considered a PBP. In this respect it resembles the homologous protein VanY from VanA- and VanB-type enterococcal

strains. This study extends the number of identified penicillin-binding proteins from the original five [7, 10] to the final number of nine which represents the full set of these proteins in L. monocytogenes. Methods Strains, plasmids and growth conditions E. coli BL21(DE3) and DH5α were grown aerobically at 37°C on Luria-Bertani (LB) medium. L. monocytogenes strains were

high throughput screening assay grown on Tryptic Soy Broth Yeast Extract (TSBYE) and Brain Heart Infusion (BHI) media at 37°C unless selleck compound otherwise stated. Plates of solid LB or TSBYE media were prepared following the addition of agar to 1% (w/v). Ampicillin (100 μg/ml) or kanamycin (30 μg/ml) and chloramphenicol (10 μg/ml) were added to broth or agar media as required. When necessary, 0.1 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) and X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) (20 μg/ml) were spread on agar plates 30 min prior to plating. The bacterial strains, plasmids and oligonucleotide primers used in this study are shown in Tables 6 and 7. Table 6 Strains and plasmids used in this study Strain or plasmid Relevant genotype and features Reference or

source strains EGD L. monocytogenes wild-type   KD2812 Δlmo2812 derivative of EGD This work AD07 Δlmo2754 derivative of KD2812 This work E. coli DH5α F- Φ80 Δ lacZM15(lacZYA-orgF) U169 deoR recA1 endA1 hsd R17 phoA Clomifene supE44kλ- thi-1 gyrA96 relA1   E. coli BL21(DE3) F- ompT gal dcm hsdSB(rB – mB -) λ(DE3) Novagen plasmids pET30a   Novagen pAD3 pET30a derivative containing lmo2812 gene This work pKSV7 temperature-sensitive integration vector; MCS a ; lacZ; β-lac; cat, pE194 Ts rep [31] pKD2812 pKSV7 carrying the Δlmo2812 allele This work pADPBP5 pKSV7 carrying the Δlmo2754 allele This work a MCS – multiple cloning site Table 7 Oligonucleotide primers used in this study primer Sequence 5′→3′ pET6up3 a AGCAAATCATATGGCGGTTTATTCAGTCG pET6down a ATGCTCGAGATCTTCTTTAAACCCAACCTC La2812 ATCCGCTATCTGAATCGCCT Pb2812 b TTCAGCTGTTCCAATTATTGCTCCGTAGAACAGGCTG Lc2812 TTGGAACAGCTGAACGTGGA Pd2812 CTAGAGTCAATCCGCAGCCA La2754 CCGTTATTGACATCTGCTAC Pb2754 b CCGCAGAAGCACCAATAACTGCCAGCGACGTTGAA Lc2754 TTGGTGCTTCTGCGGCTTGT Pd2754 TAGCAGATGGCATCATCCGG a Nucleotide substitutions to create restriction sites are underlined b Overhangs complementary to SOE primers are underlined Construction of L.

Comments are closed.