Piceatannol protects against sepsis-induced myocardial dysfunction via
direct inhibition of JAK2
Lingpeng Xie a,1
, Yuting Wu a,c,1
, Chuying Zhou a,1
, Zhangbin Tan b
, Honglin Xu a
,
Guanghong Chen a
, Hongmei Chen a
, Guiqiong Huang d
, Huijie Fan e
, Lei Gao a,*
, Bin Liu b,*
,
Yingchun Zhou a,*
a School of Traditional Chinese Medicine, Department of Traditional Chinese Medicine, Nanfang Hospital (ZengCheng Branch), Southern Medical University, Guangzhou
510515, China b Department of Traditional Chinese Medicine (Institute of Integration of Traditional and Western Medicine of Guangzhou Medical University, State Key Laboratory of
Respiratory Disease), the Second Affiliated Hospital of Guangzhou Medical University, Guangzhou Medical University, Guangzhou 510260, China c Department of Traditional Chinese Medicine, Binzhou Medical University Hospital, Binzhou 256603, China d Department of Internal Medicine, Huizhou Hospital of Guangzhou University of Traditional Chinese Medicine, Huizhou 516000, China e TCM Health Construction Department of Yangjiang People’s Hospital, Guangdong Province, Yangjiang 529500, China
ARTICLE INFO
Keywords:
Piceatannol
JAK2
Sepsis-induced myocardial dysfunction
Inflammation
Apoptosis
ABSTRACT
Sepsis-induced myocardial dysfunction (SIMD) represents one of the serious complications secondary to sepsis,
which is a leading cause of the high mortality rate among septic cases. Subsequent cardiomyocyte apoptosis,
together with the uncontrolled inflammatory response, has been suggested to be closely related to SIMD.
Piceatannol (PIC) is verified with potent anti-apoptotic and anti-inflammatory effects, but its function and
molecular mechanism in SIMD remain unknown so far. This study aimed to explore the potential role and
mechanism of action of PIC in resisting SIMD. The interaction of PIC with JAK2 proteins was evaluated by
molecular docking, molecular dynamics (MD) simulation and surface plasmon resonance imaging (SPRi). The
cecal ligation and puncture-induced septicemia mice and the LPS-stimulated H9C2 cardiomyocytes were prepared as the models in vivo and in vitro, separately. Molecular docking showed that JAK2-PIC complex had the
− 8.279 kcal/mol binding energy. MD simulations showed that JAK2-PIC binding was stable. SPRi analysis also
showed that PIC has a strong binding affinity to JAK2. PIC treatment significantly ameliorated the cardiac
function, attenuated the sepsis-induced myocardial loss, and suppressed the myocardial inflammatory responses
both in vivo and in vitro. Further detection revealed that PIC inhibited the activation of the JAK2/STAT3
signaling, which was tightly associated with apoptosis and inflammation. Importantly, pre-incubation with a
JAK2 inhibitor (AG490) partially blocked the cardioprotective effects of PIC. Collectively, the findings demonstrated that PIC restored the impaired cardiac function by attenuating the sepsis-induced apoptosis and
inflammation via suppressing the JAK2/STAT3 pathway both in septic mice and H9C2 cardiomyocytes.
1. Introduction
Sepsis, especially for septic shock and severe sepsis, is characterized
by the organ dysfunction-associated disturbed infection immune
response [1]. In the United States, an incidence of over 300/100,000
persons is reported for septic shock and severe sepsis every year [2].
Sepsis accounts for 35% of all hospitalizations resulting in death [3]. The
sepsis-induced myocardial dysfunction (SIMD) stands for a frequently
Abbreviations: AST, spartate aminotransferase; Bax, BCL2-associated X; Bcl-2, B-cell lymphoma-2; CK, creatine kinase; CLP, cecal ligation and puncture; DMEM,
Dulbecco’s modified Eagle’s medium; EF, ejection fraction; ELISA, Enzyme-Linked Immunosorbent Assay; FBS, fetal bovine serum; FS, fractional shortening; H&E,
hematoxylin-eosin; IHC, Immunohistochemistry; IL-6, Interleukin 6; JAK/STAT, Janus kinase/signal transducer and activator of transcription; MD, molecular dynamics; PIC, piceatannol; RT-PCR, Real-time PCR; SIMD, sepsis-induced myocardial dysfunction; SPRi, surface plasmon resonance imaging; TNF-α, tumor necrosis
factor alpha; TUNEL, Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling.
* Corresponding authors.
E-mail addresses: [email protected] (L. Gao), [email protected] (B. Liu), [email protected] (Y. Zhou). 1 These authors contributed equally to this research.
Contents lists available at ScienceDirect
International Immunopharmacology
journal homepage: www.elsevier.com/locate/intimp
https://doi.org/10.1016/j.intimp.2021.107639
Received 22 October 2020; Received in revised form 24 March 2021; Accepted 31 March 2021
International Immunopharmacology 96 (2021) 107639
2
seen and critical complication secondary to severe sepsis, which is also a
major reason for deaths, especially for the critical cases. It was reported
that SIMD cases were associated with a high mortality rate of as high as
70%, far exceeding that of sepsis patients without myocardial dysfunction [4]. Previous studies have demonstrated that the uncontrolled inflammatory response and the subsequent cardiomyocytes loss are the
major determinants of SIMD [5]. The existing conventional treatments
can not attain satisfactory therapeutic effect in clinical practice. As a
result, it is of great clinical significance to discover a drug to reduce
these pathological changes to prevent SIMD.
PIC (piceatannol) is a structural analogue of resveratrol, which
shows extensive pharmacological activities such as antitumor, antiinflammation and antioxidant effects, and is widely distributed in
plants of grapes, passion fruit, white tea, and Japanese knotweed [6].
PIC is the component that has close chemical structure compared with
resveratrol, and it is suggested to be more preferentially active than
other natural stilbenes like resveratrol and oxyresveratrol, because of
the amount and substituted position of hydroxyls [7]. As indicated in
previous studies, PIC exerts cardioprotective effects, including the inhibition of hypoxia-induced toxicity in H9C2 cardiomyocytes [8] and
the suppression of arrhythmias during the ischemic events [9]. Moreover, PIC is demonstrated to inhibit the signal transducers and activate
the transcription 1/3 pathway to inhibit the IL-6 expression within
human umbilical vein endothelial cells (hUVECs) at mRNA as well as
protein level [10]. However, its potential effects on SIMD are largely
unknown.
The Janus kinase/signal transducer and activator of transcription
(JAK/STAT) pathway is closely related to various biological processes,
such as tumor proliferation, apoptosis, metastasis and inflammation
[11,12]. Previous study revealed that the JAK2/STAT3 pathway was
tightly related to acute organ damage, septic shock and uncontrolled
inflammatory response [13]. Besides, experimental studies confirmed
that the JAK2/STAT3 pathway was hyperactivated in both the cellular
and animal models of sepsis [14], suggesting that the JAK2/STAT3
signaling pathway activation is related to systemic inflammatory
response genesis and progression [12]. Numerous data indicate that
inhibition of the JAK2/STAT3 signaling pathway is specifically involved
in preventing myocardial injury [15,16]. However, the role of the JAK2/
STAT3 pathway in PIC-mediated cardioprotection on the septic heart
has not been clarified yet.
In this study, sepsis models were established through cecal ligation
and puncture (CLP) in vivo and the LPS-treated H9C2 cells in vitro, for the
sake of investigating how PIC pre-treatment affected SIMD and
exploring the underlying mechanism of the JAK2/STAT3 signaling
pathway in mediating the cardioprotective effects of PIC.
2. Materials and methods
2.1. Materials
Piceatannol (CAS# 10083–24-6, HPLC ≥ 98%) was purchased from
Chengdu Must Biological Technology, China. Antibodies against STAT3,
phospho-STAT3(Tyr705), JAK2, Bax, Bcl-2, Caspase3, p65, phosphop65, phospho-IκBα and GAPDH were commercially obtained from CST
(Danvers, MA, USA). Antibodies against IL-6 and TNF-α were obtained
from Zen Bioscience (Chengdu, China). Antibodies against phosphoJAK2 (Tyr 1007) was obtained from Affinity Biosciences (Changzhou,
China). The CellTiter 96® AQueous One Solution cell proliferation assay
(MTS) was purchased from Promega (Madison, WI, USA). AG490 were
purchased from MedChem Express (Monmouth Junction, NJ, USA).
Piceatannol was purchased from Chengdu Mansite Biotechnology
(Chengdu, China). Other reagents used in this study were obtained from
reagent companies.
2.2. Molecular docking and molecular dynamics simulation (MD)
The Autodock Vina (Scripps Research Institute, United States) was
utilized to analyze molecular docking for analyzing the mechanism of
binding of JAK2 (PDB ID: 2B7A) with PIC (ZINC ID: 5552326). To this
end, the bound ligands as well as water molecules were removed to
prepare the JAK2 protein structure for molecular docking. In addition,
YASARA was applied in performing ligand energy minimization. The
protein–ligand binding site of JAK2 was located in the inhibitor-binding
domain. In MD simulation, star conformation was deemed as the optimal
conformation. MD simulation was performed using YASARA. Each
simulation was operated by the use of AMBER 03 forcefield. In brief,
0.9% NaCl was added into the dodecahedron box to dissolve the receptor ligand complex, with the box-solute distance of 5 Å. For simulated annealing minimization, the initialization conditions were as
follows, 298 K, velocity decreasing by 0.9 at the intervals of 10 steps for
5 ps. Upon the completion of energy minimization, this study utilized
Berendsen thermostat to control simulation temperature. Moreover,
reinitialization of those nonaxial velocity components was performed at
the intervals of 100 simulation steps. At last, 100-ns MD simulations
were carried out at the 2 fs rate, while the complex coordinates were
preserved at the intervals of 10 ps.
2.3. Surface plasmon resonance imaging (SPRi)
SPRi technology was performed following the previous description
[17]. First, the chip was activated with EDC/NHS, and then 0.43 mg/ml
JAK2 protein was spotted on the surface of the 3D Dextran chip, followed by incubation at 4 ◦C for 12 h. Thereafter, the surface was treated
with deionized water/ethanol washing and nitrogen draining. PBS
(pH¼7.4) served as the running buffer solution. Then, SPRi was
measured according to previous description [18]. After achieving stable
baseline, PIC at diverse doses was injected into the flow cell. Afterwards,
the Plexera PlexArray SPRi instrument was utilized to perform the assay,
and Instrument Control was employed for visualization, while Plexera
Data Explorer was used for analysis.
2.4. Animal model establishment
The animal procedures gained approval from the Institutional Animal Care and Use Committee (IACUC) of Southern Medical University
(L2018017). The wild-type (WT) male C57BL/6 mice (age, 8 weeks old;
weight, 22–26 g) were provided by the Animal Laboratory of Southern
Medical University (Guangzhou, China). The animals were housed (4
mice/cage, 12 h light/dark cycle) under pathogen-free conditions in
temperature (22 ± 2 ◦C) and humidity (55 ± 10%), and were raised
using standard food with free access to tap water. Then, all animals were
randomized as 4 groups of 15 mice, including sham-operation (Sham),
CLP, PIC 20 mg/kg (PIC), and JAK2 inhibitor 10 mg/kg (AG490) groups.
The Sham and CLP groups were treated with distilled water. The PIC
groups were pre-treated with PIC by gavage and the AG490 groups were
injected intraperitoneally with AG490 for 3 days before the operation.
After the pretreatment, the cecal ligation and puncture to induce severe
sepsis was performed. Firstly, 1% sodium pentobarbital (100 mg/kg)
was injected intraperitoneally into mice for anesthesia. Secondly, mice
were placed onto laboratory bench on supine position, and the surgical
area was prepared and sterilized. Then, an incision (1.5 cm) was made in
the central abdomen to separate and completely expose the cecum. Afterwards, the no. 4 sterile sewing silk was used to ligature cecum at a
place 1 cm from its tail, and the blind end was perforated, while an
appropriate amount of feces sample was collected with an 18-gauge
needle. Then, the cecum was put back to the abdomen, followed by
abdominal incision suturing. Postoperatively, the animals were given
subcutaneous injection with 1 ml normal saline (NS) on mouse back to
perform fluid resuscitation. Meanwhile, the mice were transferred
within the constant temperature blanket to rewarm them. Operation in
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
3
sham group was the same except that no CLP was performed.
2.5. Echocardiography
The transthoracic echocardiography was performed to assess cardiac
function using a Vevo 2100 ultrasound imaging system (VisualSonics,
Toronto, Canada). To begin with, mice were anesthetized with 1.5%
isoflurane and then subjected to echocardiographic examination. Then,
the parameters of cardiac function including ejection fraction (EF),
fractional shortening (FS) were collected.
2.6. Biochemical analysis
Blood sample was subjected to 4 min of centrifugation at 3000g and
4 ◦C after CLP for obtaining serum sample. Thereafter, the plasma level
of aspartate aminotransferase (AST) together with creatine kinase (CK)
was measured in accordance with the instructions (Institute of Jiancheng Bioengineering, Nanjing, China).
2.7. Analysis of MDA contents and SOD activities within heart tissue
samples
The heart tissue sample was subjected to homogenization within NS.
Then, the supernatants were collected from the homogenate by centrifugation at 12,000g for 20 min under 4 ◦C. The MDA contents and SOD
activities in the tissues were detected and analyzed using specific test
kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) in
accordance with kit instructions.
2.8. Histological evaluation and Immunohistochemistry (IHC)
Heart tissues were harvested and fixed with 4% paraformaldehyde
for 48 h, followed by gradient ethanol dehydration, paraffin embedding,
and slicing to the 4-µm-thick sections. Afterwards, hematoxylin-eosin
(H&E) staining was performed on these sections. Then, xylene and
gradient ethanol were used for the sequential deparaffinage of heart
tissue sections. After heating within the 0.01 mol/L sodium citrate buffer
(pH 6.0) for 10 min to 121 ◦C, the sections were cooled down and rinsed
by the phosphate buffered saline (PBS) thrice, followed by 10 min of
incubation using the 3% H2O2 under 37 ◦C for blocking the endogenous
peroxidase and washing by PBS. Then the normal goat serum working
solution was utilized to block the non-specific antibody binding site for
15 min. Later, the Bax, anti-p-JAK2 and anti-p-STAT3 primary antibodies were adopted for overnight sample incubation under 4 ◦C.
Thereafter, the biotinylated secondary antibody was adopted to incubate sample under ambient temperature for 30 min. DAB was used to
stain all sections in dark under ambient temperature, and hematoxylin
was utilized to stain nuclei.
2.9. Real-time PCR (RT-PCR)
The Trizol reagent (Invitrogen Corporation, Carlsbad, CA, USA) was
used to isolate total RNA from myocardial tissues following specific
protocols. Then, cDNA was prepared through the reverse transcription
of the isolated total tissue RNA for 15 min under 37 ◦C, 5 s under 85 ◦C
and under 4 ◦C using a PrimeScript™ RT reagent Kit (Takara, Japan).
Thereafter, RT-PCR was performed with SYBR Green (Takara) to
quantify the messenger RNA (mRNA) on Thermal Cycler Dice™ Real
Time System II. The relative mRNA level was determined based on the
threshold cycle (Ct) value according to 2-△△CT method, with GAPDH as
the reference. Table 1 shows the primers utilized in RT-PCR in the
present work. Table 1 shows the primers utilized in RT-PCR.
2.10. Enzyme-Linked Immunosorbent assay (ELISA)
The proinflammatory factor concentrations, including IL-6, IL-1β and
TNF-α in serum were determined using the ELISA detection kits
(DAKEWE, Shenzhen, China) in accordance with the manufacturer
instructions.
2.11. Cell culture
The rat cardiomyoblast H9C2 cells were provided by Cell Bank of
Type Culture Collection of the Chinese Academy of Sciences (Shanghai,
China). Then, the cells were cultivated within the DMEM (Gibco, Grand
Island, NY, USA) containing 10% fetal bovine serum (FBS) (Gibco Laboratories, USA), together with penicillin (100 U/ml) and streptomycin
(100 mg/ml) under 37 ◦C, 5% CO2 and humid environment. DMEM
containing 2% FBS was used to replace the original medium before
treatment. To carry out experiments, PIC at diverse doses (10, 20, 40
μM) was used to incubate cells for 1 h before LPS (10ug/ml) treatment.
To inhibit JAK2, the JAK2 inhibitor (AG490, 10 μM) was utilized to treat
the H9C2 cells for 1 h before LPS treatment.
2.12. Cell viability analysis
The Cell Titer 96® Aqueous One Solution Cell Proliferation Assay
(MTS, Promega, Madison, WI, United States) was adopted to determine
the viability of cells within the 96-well plates following the manufacturer’s protocol. After treatment, the medium in each well was mixed
with 20 μl MTS solution to continuously incubate for 1 h under 37 ◦C.
Then, the automatic microplate reader (Gene Company, Hong Kong,
China) was used to measure absorbance value (OD) at 490 nm. Finally,
the cell viability value was expressed as the percentage based on control
group.
2.13. TUNEL staining
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) was performed to detect apoptotic nuclei by TUNEL
Staining Kit (Roche, Indianapolis, IN) according to the manufacturer’s
protocol. The number of apoptotic cells with TUNEL-positive nuclei was
counted by 2 independent observers blinded to the treatment group and
expressed as a percentage of the total myocyte population.
2.14. Western blotting
The myocardial tissue samples or H9C2 cell line were lysed on ice
within the RIPA buffer (Beyotime Institute of Biotechnology, Shanghai,
China) containing phosphatase and protease inhibitors (cocktail tablet;
Roche Applied Science, Switzerland). After harvesting the supernatants
of lysates through 15 min of centrifugation under 10,303 g and 4 ◦C, the
concentrations were measured with the bicinchoninic acid (BCA) protein detection kit (Thermo, USA) in accordance with specific protocols.
Table 1
Primers used in RT-PCR.
Gene Species Forward primer Reverse primer
IL-1β Mouse TCAAATCTCGCAGCAGCACATC CGTCACACACCAGCAGGTTATC
IL-6 Mouse CCCCAATTTCCAATGCTCTCC CGCACTAGGTTTGCCGAGTA
TNF-a Mouse TGGAACTGGCAGAAGAGGCAC AGGGTCTGGGCCATAGAACTGA
GAPDH Mouse AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
4
SDS-PAGE was adopted to load the aliquots of proteins in each lane, then
proteins were transferred to the PVDF membranes (Millipore, Bedford,
MA, USA). Later, the membranes were blocked with bovine serum albumin (BSA, Roche) dissolved within the tris-buffered saline containing
5% Tween 20 (TBST) buffer for 2 h. Later, the target proteins were
incubated with specific antibodies (Bax, Bcl2, Caspase3, p-p65, p-IκBα,
p-JAK2, JAK2, p-STAT3, STAT3, IL-6, TNF-α, GAPDH; all dilutions,
1:1000), respectively, overnight under 4 ◦C. Later, TBST was used to
wash the membranes thrice for 10 min each, and the specific secondary
antibody was applied in additional 2 h of incubation under 4 ◦C. The
Mini Chemi (Sage Creation, Beijing, China) was utilized to detect band
signals. Image J was employed for quantifying the intensity of membranes, while GAPDH was used for normalization.
2.15. Immunofluorescence
The H9C2 cells seeding onto slides, were washed three times with
PBS buffer and fixed with 4% Paraformaldehyde. Between all following
steps, cells were rinsed with PBS buffer for 5 min three times. Cells were
permeabilized with a solution of PBS containing 0.1% Triton X100 for
10 min and incubated with blocking solution (PBS containing 5%
normal goat serum solution) for 2 h at RT, before being incubated with
the primary antibody appropriately diluted in blocking solution overnight in a humidified chamber at 4 ◦C. Cells were then incubated with
the secondary antibody for 2 h, goat anti-rabbit Alexa Fluor 568-conjugated IgG (1:400, Life Technologies). Then the cells counterstained with
DAPI for 5 min at RT after being rinsed with PBS buffer for 5 min.
Following been rinsed with PBS buffer for 5 min twice, the cells slides
were coverslipped with fluorescent mounting medium (Solarbio).
Negative controls were performed omitting the primary antibodies.
2.16. Statistical analysis
The quantitative data are presented as mean ± SD values. Analysis
was performed using GraphPad Prism software, version 5.0 (GraphPad
Software, La Jolla, CA). One-way ANOVA was used to evaluate the
statistical significance of differences in multi-group designed experiments, followed by Tukey’s multiple comparison tests on dependent
experimental designs. In all cases, data from at least three independent
experiments were used. P values of < 0.05 were considered statistically
significant and P values of < 0.01 were considered statistically highly
significant.
Fig. 1. PIC interacted with JAK2 directly. (A) The molecular structure of PIC. (B) 3D crystal structure for PIC in the PIC-JAK2 complex. (C) Presentation of the
crystal structure surface for the JAK2-PIC complex at 0/100 ns. (D) RMSD plots for CA atom (red), backbone atoms (blue) and all atoms in JAK2 protein (green) and
all atoms in PIC (pink). (E) SPRi fitting curves for the five gradients of PIC concentrations to JAK2 protein.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
3. Results
3.1. PIC interacted with JAK2 directly
According to the present knowledge, the JAK2/STAT3 pathway is
significantly related to the sepsis-induced acute organ damage and uncontrolled inflammatory response [9]. As revealed by previous research,
PIC inhibits the JAK2/STAT3 pathway to alleviate inflammation [10].
The molecular structure of PIC is presented in Fig. 1A. In the present
work, molecular docking study was performed for exploring the association of PIC with the JAK2/STAT3 pathway through the Autodock
Vina docking procedure. As suggested by our docking results, the JAK2-
PIC complex had the − 8.279 kcal/mol binding energy, indicating that
PIC was closely associated with JAK2. Fig. 1B presents the 3D binding
conformational structure for the JAK2-PIC complex. A total of 8
hydrogen bonds were formed of PIC with LEU-932, LEU-855, GLY-935,
LEU-983, ASP-994, VAL-863, ALA-880 and TYR-931 of JAK2. Subsequently, for better verifying those molecular docking results, JAK2-PIC’s
optimal conformation served to be the starting conformation to carry out
MD simulation using YASARA. Fig. 1C displays those surface visualization models for JAK2-PIC. As observed, stable existence of PIC at the
JAK2 binding site center was seen, till the completion of MD simulation.
The minimum structure evolution of heavy atoms root-mean-square
deviation (RMSD) in the complex is presented in Fig. 1D. The RMSD
tracks of CA atom and Backbone atoms in JAK2 protein fluctuated at
approximately 1.5 Å between 0 and 100 ns. The average RMSD values
were 1.509 Å and 1.552 Å, respectively (Fig. 1D, red and blue lines).
During the MD simulation, the RMSD values of all atoms in JAK2 protein
fluctuated at around 2 Å, and the average RMSD value was 2.081 Å
(Fig. 1D, green line). Besides, the RMSD track of PIC fluctuated between
0.3 and 0.4 Å during MD simulation, and the average RMSD value was
0.328 Å (Fig. 1D, pink line). Based on the above findings, there was
stable binding of JAK2 with PIC, and JAK2 was possibly the direct target
of PIC.
To test our hypothesis, the SPRi technology was applied in evaluating the interaction of the PIC-JAK2 complex. The JAK2 protein was
immobilized on the 3D-Carbene Surface chip and its binding affinity to
PIC was determined. It was discovered that, PIC rapidly bound to JAK2
in a dose-dependent manner. PIC showed significant signals on the chip
and the KD value determined by SPRi technology was 5.16 μM (Fig. 1E).
Such result agreed reasonably with those determined by molecular
docking analysis and MD simulation, implying that there was a strong
and stable affinity of PIC for JAK2.
3.2. PIC alleviated myocardial damage in mice after CLP
First, the cardiac function of mouse sepsis models was evaluated by
echocardiography. In the CLP group, the ejection fraction and fraction
shortening were significantly lower than in the sham groups. PIC and
AG490 significantly improved cardiac function of CLP-treated mice, as
evidenced by increased ejection fraction and increased fraction shortening (Fig. 2A-C). HE staining of myocardial tissues was performed for
exploring the function of PIC in protecting against the CLP-mediated
myocardial injury. Histological examination showed that both PIC and
AG490 significantly alleviated the CLP-induced degeneration of cardiomyocytes. In addition, they also mitigated the CLP-induced pathological changes, including degeneration, interstitial edema, and necrosis
(Fig. 2A). CLP group had significantly increased AST and CK contents in
serum. On the contrary, PIC and AG490 efficiently reduced the markers
of myocardial damage (Fig. 2D-E). The excess oxidative stress (OS) will
result in cell damage, finally leading to cell death. Relative to sham
group, CLP group had increased level of MDA (the intermediate of lipid
peroxidation), whereas reduced SOD activity. Relative to CLP group, PIC
and AG490 ameliorated OS, as indicated by the reduced MDA
Fig. 2. PIC alleviated myocardial damage in mice after CLP. (A) Representative echocardiographic images of each group. Pathological changes of myocardial
tissues under HE staining (200×). Bax levels examined via IHC staining (400×) (B-C) Left ventricular ejection fraction and left ventricular fractional shortening. (D-E)
Serum levels of CK and AST. (F-G) SOD and MDA levels in the heart. (H) Apoptosis-associated protein expression, such as Caspase3, Bax, and Bcl-2, together with
their quantification detected through Western blotting (I-J). Data are presented in the manner of mean ± SD, n = 6. #p < 0.05, ##p < 0.01 versus Sham group; *p <
0.05, **p < 0.01 versus CLP group.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
production while enhanced SOD activity of treatment group (Fig. 2F-G).
Furthermore, Western boltting and IHC staining were performed for
determining apoptosis-associated protein levels. For CLP group, Bax and
Cleaved-Caspase 3 (the apoptotic proteins) expression levels obviously
elevated, while PIC and AG490 treatment reduced the protein levels.
Meanwhile, PIC and AG490 enhanced the Bcl-2-to-Bax ratio relative to
CLP group (Fig. 2A, H-J).
3.3. PIC reduced inflammation in septic mice
The inflammatory cytokines exert important parts in SIMD. To assess
systemic inflammation, the peripheral blood contents of inflammatory
cytokines were detected, as shown in Fig. 3A-C. Relative to sham
operation group, CLP group had significant elevated inflammatory
cytokine contents (IL-6, IL-1β and TNF-α), with the differences being of
statistical significance. Following PIC and AG490 treatments, the levels
of inflammatory cytokines decreased significantly. Additionally, the
contents of inflammatory cytokines within the heart tissue homogenate
were examined by using the qPCR technology, which led to similar results to those obtained in serum (Fig. 3D-F).
3.4. PIC inhibited the activation of JAK2/STAT3 in CLP-induced
myocardial injury
The JAK2/STAT3 pathway has been demonstrated to play a crucial
role in sustaining tissue inflammation [11]. This study detected the
phosphorylated levels of JAK2 and STAT3 in the heart after CLP.
Consistent with previous reports, CLP activated the tyrosine phosphorylation of JAK2/STAT3. It was also discovered that our treatment with
PIC and AG490 inhibited the CLP-induced phosphorylation of JAK2
(Fig. 4A, 4B) together with STAT3 (Fig. 4A, 4C) within the heart. The
levels of p-JAK2 and p-STAT3 in heart tissues were further detected
using IHC staining (Fig. 4D). Compared with Sham group, mice of CLP
group presented higher expression levels of p-JAK2 and p-STAT3.
Similarly, PIC and AG490 inhibited the expression of p-JAK2 and pSTAT3. These results suggested that PIC suppressed the JAK2/STAT3
pathway, which might subsequently reduce the local inflammation and
cardiac damage.
3.5. PIC alleviated apoptosis of LPS-stimulated H9C2 cells
To examine the function of PIC in protecting from LPS-meidated
injury, the H9C2 cell line was pretreated with PIC for 1 h at indicated
concentrations (10, 20, and 40 μM), followed by additional 24 h of
stimulation with LPS (10 μg/ml). Cell viability was detected by MTS
assay, the cell apoptosis index was determined by TUNEL staining, and
expression of apoptosis-associated proteins was detected by Western
blotting. As a result, LPS treatment dramatically decreased H9C2 cell
viability compared with that in control group. Pretreatment with PIC
outstandingly enhanced H9C2 cell viability relative to LPS group
(Fig. 5C). Besides, the function of PIC in resisting the apoptosis of H9C2
cells was detected through TUNEL staining. It was illustrated from
Fig. 5A and 5B that, LPS group had apparently elevated apoptotic cells,
while that in PIC group was markedly reduced. Consistent with the results of TUNEL staining, Bax and Cleaved-Caspase 3 proteins of LPS
group had obviously increased apoptotic levels relative to control group,
while PIC reduced the levels of these two proteins. Meanwhile, the Bcl-2-
to-Bax ratio was enhanced by PIC compared with LPS (Fig. 5D-F).
3.6. PIC suppressed inflammation of LPS-stimulated H9C2 cells
To verify the anti-inflammatory effects of PIC, this study investigated
TNF-α and IL-6 contents within the supernatants of H9C2 cells after PIC
and LPS treatments. As observed in Fig. 6B and 6C, pretreatment with
PIC attenuated the LPS-induced production of TNF-α and IL-6 depending
on the LPS dose. Likewise, the results indicated that PIC inhibited TNF-α
and IL-6 protein levels in the LPS-treated H9C2 cells (Fig. 6D, G-H).
Meanwhile, treatment of PIC significantly inhibited LPS-induced phosphorylation of p65 and IκBα (Fig. 6D, E-F). In addition, an immunofluorescence assay revealed that PIC significantly reduced the level of p65
in the nucleus of H9C2 cells induced by LPS (Fig. 6A). Collectively, the
above findings indicated that, pretreatment with PIC protected from the
inflammation of H9C2 cells induced by LPS.
3.7. PIC inhibited the activation of the JAK2/STAT3 signaling pathway
The JAK2/STAT3 signaling pathway activation has been identified to
Fig.3. PIC reduced inflammation in septic mice. (A-C) Serum levels of TNF-α, IL-6, and IL-1β. (D-F) TNF-α, IL-6, and IL-1βmRNA levels within myocardial tissues
detected by qPCR. Data are presented in the manner of mean ± SD, n = 6. #p < 0.05, ##p < 0.01 versus sham group; *p < 0.05, **p < 0.01 versus CLP group.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
7
participate in inflammation and apoptosis. This study performed Western blotting to detect key molecule levels in the JAK2/STAT3 signaling
pathway for exploring the underlying mechanism of PIC in protecting
H9C2 from LPS-induced damage. Key molecule levels in the JAK2/
STAT3 signaling pathway were determined by Western blotting to
explore the mechanism of PIC in protecting H9C2 from LPS-induced
damage. It was illustrated from Fig. 7A-C that, LPS elicited JAK2 and
STAT3 phosphorylation, and pretreatment with PIC significantly
inhibited p-JAK2 and p-STAT3 expression within the LPS-injured H9C2
cells. These results indicated that PIC suppressed p-JAK2 and p-STAT3
expression.
3.8. PIC suppressed LPS-induced H9C2 cells inflammation through
inhibited JAK2/STAT3 signaling
To further verify the molecular basis of PIC in protecting against LPSinduced activation in H9C2 cells, this study further examined whether
the inhibitory effects of PIC on myocardial inflammation were mediated
via the JAK2/STAT3 signaling in H9C2 cells treated with LPS. This study
compared H9C2 cells treated with or without AG490, along with PIC and
LPS. Consistent with previous reports, after treatment with the JAK2
specific inhibitor AG490, LPS failed to increase the IL-6 and TNF-α
contents (Fig. 8A-E), while the further activation of the JAK2/STAT3
signaling induced by LPS was inhibited (Fig. 8F-H). However, cotreatment with AG490 and PIC did not enhance the inhibitory effect
of PIC to inhibit the TNF-α and IL-6 levels and p-JAK2 expression as
compared with PIC alone (P > 0.05), or even partially block the inhibitory effect of PIC on the phosphorylation level of STAT3 (P＜0.05)
(Fig. 8A-H). These results indicated that PIC acted as a potential inhibitor of JAK2, the inhibitory effect of PIC on LPS-induced H9C2 cells
inflammation are at least partly, due to through the JAK2/STAT3
signaling.
Fig.4. PIC inhibited the activation of JAK2/STAT3 in CLP-induced myocardial injury. (A) The expression of JAK2 and STAT3 detected by Western boltting and
the fold activation data analysis (B, C). (D) JAK2 and STAT3 levels examined via IHC staining (400×). Data are presented in the manner of mean ± SD, n = 3. #p <
0.05, ##p < 0.01 versus Sham group; *p < 0.05, **p < 0.01 versus CLP group.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
8
4. Discussion
Septic cardiac dysfunction remains the main reason for the morbidity
and mortality among the inpatients, and it also results in the
inflammation-induced cardiomyocyte death. Therefore, suppression and
treatment of SIMD are essential for improving septic patient prognosis.
The present work demonstrated that PIC was beneficial for treating
SIMD, which showed anti-inflammation and anti-apoptosis activities, in
the meantime of assessing the potential mechanisms based on the
myocardial damage caused by CLP as well as the LPS-stimulated H9C2
cardiomyocytes in mice. Our findings suggested that PIC suppressed
apoptosis together with inflammation through suppressing the JAK2/
STAT3 pathway.
Molecular docking and MD simulation have been developed as the
efficient approaches for characterizing the binding of protein with small
molecules. The surface plasmon resonance imaging (SPRi) biosensor is a
kind of high-throughput technique with high sensitivity, which is
extensively applied to detect the interactions among a variety of molecules, including those between protein, and those between protein and
nucleic acid [19,20]. Firstly, this study found that PIC and JAK2 had
strong binding energy, as evidenced by molecular docking and MD
simulation studies. Thereafter, the SPRi system was utilized to found
that PIC showed strong binding affinity for JAK2 protein. These results
strongly indicated that PIC interacted with JAK2 and might act as a
potential JAK2 inhibitor.
In the following animal experiments, AG490, the JAK2 specific
inhibitor, was used as a positive control drug. Meanwhile, the effect of
AG490 on mitigating myocardial damage in septic mice was also
observed to explore the mechanism of the JAK2/STAT3 pathway in the
occurrence and development of sepsis.
For investigating the sepsis pathophysiology, different animal
models are established. Among them, the CLP-induced polymicrobial
sepsis model closely resembles the progression and characteristics of
sepsis in human beings, and it greatly contributes to understanding
those inflammatory components participating in sepsis and to identifying the therapeutic targets [21]. According to the results of echocardiography, we found that PIC and AG490 can improve the cardiac
function of septic mice. After surgery, mice showed myocardial cell
degeneration, interstitial edema and necrosis. After PIC and AG490
treatments, the pathological changes in heart were alleviated obviously.
Previous study has indicated that the CK and AST levels in serum are
closely associated with damage to myocardial tissues, which can be used
to be the signs for myocardial injury [22]. In this study, CLP treatment
significantly increased the serum contents of CK and AST, which was
reversed by PIC treatment and AG490 treatment. MDA is one of the
polyunsaturated fatty acid (PFA) end-products, and it is generally utilized to be an index to evaluate the cardiac lipid peroxidation [23]. SOD
possesses extensive physiological effects, such as anti-inflammation and
antioxidation [24]. As suggested by results in this work, PIC and AG490
treatments remarkably decreased the MDA level and reversed the SOD
activity. Myocardial loss due to apoptosis or necrosis might cause cardiac dysfunction after sepsis. Our study also discovered that, PIC and
Fig.5. PIC alleviated apoptosis of LPS-stimulated H9C2 cells. PIC at different doses (10, 20 and 40 μМ) was used to treat H9C2 cells for 1 h, followed by another
24 h of stimulation by LPS (10 μg/ml). (A-B) The apoptotic cell index of H9C2 cells was detected by TUNEL staining. (C) The H9C2 cell viability was measured via
MTS assay. (D) Levels of apoptosis-associated proteins (such as Caspase3, Bax and Bcl-2) and quantification (E through F). Data are expressed in the manner of mean
± SD, n = 3. #p < 0.05, ##p < 0.01 versus control; *p < 0.05, **p < 0.01 versus LPS group.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
9
AG490 obviously increased the ratio of Bcl-2 to Bax and weakened
Cleaved-Caspase 3 activity, which indicated the suppression of
apoptosis. PIC improved the myocardial function in septic mice by
suppressing cardiomyocyte apoptosis, and this was also found in mice
with myocardial damage induced by ischemia–reperfusion [25]. It
further showed that PIC treatment and inhibition of the JAK2/STAT3
pathway mitigated the pathological progression of myocardial tissues
and protected from SIMD.
LPS is usually produced by the gram-negative bacteria, and it has
been identified as the central mediator of sepsis and the sepsis-related
multiple organ dysfunction or death [26,27]. LPS is a kind of endotoxin, which obviously facilitates the secretion of inflammatory cytokines, like TNF-α, IL-1β, and IL-6 [28]. In this work, PIC remarkably
attenuated the LPS-elicited cell toxicity and enhanced the cell viability
depending on its dose. Additionally, Bax and Cleaved-Caspase 3 protein
levels were up-regulated, while the Bcl2/Bax ratio decreased in H9C2
Fig.6. PIC suppressed inflammation of LPS-stimulated H9C2 cells. (A) The transportation of P65 was determined for immunofluorescent staining by using an
anti-p65 antibody (red). Dapi was used to counterstain nuclei (blue). (B-C) Supernatant levels of TNF-α and IL-6. (D-H) Protein levels of p-p65, p-IκBα, TNF-α and IL-
6, together with their quantification. Data are expressed in the manner of mean ± SD, n = 3. #p < 0.05, ##p < 0.01 versus control; *p < 0.05, **p < 0.01 versus
LPS group.
Fig.7. PIC inhibited the activation of the JAK2/STAT3 signaling pathway. PIC at diverse doses (10, 20 and 40 μМ) was used to treat H9C2 cells for 1 h, followed
by 24 h of 10 μg/ml LPS treatment. (A) p-JAK2 and p-STAT3 protein levels, together with their quantification (B and C). Data are expressed in the manner of mean ±
SD, n = 3. #p < 0.05, ##p < 0.01 versus control; *p < 0.05, **p < 0.01 versus LPS group.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
10
cells upon LPS stimulation.
The uncontrolled pro-inflammatory factors, such as IL-6, IL-1β and
TNF-α, are considered as the crucial pathogenic factors of sepsis and the
major cause of myocardial injury [29]. The serum TNF-α and IL-1β
contents are high among septic patients [30]. Previous study has
revealed that these inflammatory factors significantly increase after
myocardial infarction and are related to the subsequent myocardial
damage [31]. This study evaluated the degree of systemic inflammation
in sepsis by measuring the levels of TNF-α, IL-6 and IL-1β. Findings in
this work revealed that PIC significantly reduced the sepsis-induced
inflammatory response both in vivo and in vitro, accompanying with
the decreased level of cardiomyocyte apoptosis. Pretreatment with PIC
suppressed LPS-induced the phosphorylation of p65 and p65 nuclear
import, which suggested that NF-κB nuclear localization signals are
maintained in an inactive state when treated with PIC, and NF-κB
inactivation inhibits downstream transcription and the expression of
pro-inflammatory cytokines. Such result suggested that the effect of PIC
on controlling the inflammatory factors might be associated with its
protective effects.
The JAK2/STAT3 pathway plays a vital part in the transduction of
cytokine signaling, which is also tightly related to inflammation and
participates in apoptosis [32,33]. The JAK2/STAT3 signaling pathway is
reported to exert an important part in the inflammatory and immune
responses [34,35]. According to prior work, activating the JAK2/STAT3
signaling contributes to releasing TNF-α, IL-6 and IL-1β, which participates in diverse illnesses, such as acute organ damage, inflammatory
response, as well as septic shock [36]. Besides, inhibiting the JAK2/
STAT3 pathway mitigates myocardial injury of rats with sepsis [37].
Furthermore, inhibiting the JAK2/STAT3 pathway can down-regulate
the cytokine responses to resist against myocardial apoptosis or progressive dysfunction. Suppressing the activation of the JAK2/STAT3
signaling has been demonstrated to protect from myocardial damage in
rats with septic shock or acute myocardial infarction (ACI) [37,38]. In
this work, PIC significantly decreased p-JAK2 and p-STAT3 protein
levels in LPS-induced H9C2 cells and CLP-induced myocardial
dysfunction. Subsequently, the JAK2 inhibitor AG490 was selected as a
positive control to further clarify the anti-apoptosis and antiinflammatory mechanism of PIC. AG490, as a specific inhibitor of
JAK2, can inhibit the activity of JAK2 kinase by inhibiting the phosphorylation of JAK2 [39].It was found that the SIMD was alleviated by
the blockade of JAK2 activation using AG490, which regulated the
inflammation-related genes as well as the apoptosis-associated factors.
For investigating and verifying the function of JAK2/STAT3 pathway in
PIC protecting cardiomyocytes, H9C2 cells were pretreated with PIC +
AG490. Notably, the inhibitory effect of co-treatment with PIC and
AG490 did not further reduce the TNF-α and IL-6 levels and p-JAK2
expression compared to cells treated with AG490 or PIC alone, or even
partially block the inhibitory effect of PIC on the phosphorylation level
of STAT3. Therefore, we speculated that PIC and AG490 may effect on
the same active site of JAK2, which exert potential domain competitive
binding. Previous studies have shown that AG490 can combine well
with JAK2. The binding of AG490 was notified deep into the active site
of JAK2 due to the association of hinge region (Tyr931), N-terminal
(Val863 and Ala880) and C-terminal (Leu983 and Gly935) lobes [40].
Combined with the results of the molecular docking of PIC, we found
that both PIC and AG490 can bind to Tyr931, Gly935, Leu983, Val863
and Ala880 in the active site of JAK2. These binding sites play a key role
in JAK2 activation and are used in the research of exploring new JAK2
inhibitors [41–44]. The competitive binding of PIC and AG490 with
JAK2 may be due to the same binding region of the active site. These
results indicated that PIC acted as a potential inhibitor of JAK2, the
inhibitory effect of PIC on LPS-induced H9C2 cells inflammation are at
least partly, due to through the JAK2/STAT3 signaling, which further
verified our observation. The above findings demonstrated that PIC
protected against SIMD via the JAK2/STAT3 signaling pathway.
In conclusion, PIC can restore the impaired cardiac function by
attenuating the apoptosis and inflammation induced by sepsis in the
septic mice and H9C2 cells. Moreover, PIC possibly executes its function
through suppressing the JAK2/STAT3 pathway.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
Fig.8. PIC suppressed LPS-induced H9C2 cells inflammation through inhibited JAK2/STAT3 signaling. AG490 was used to inhibit the JAK2/STAT3 signaling
activation in this section. 40 μM PIC and 10 μM AG490 were used to treat H9C2 cells for 1 h, followed by additional 24 h of 10 μg/ml LPS stimulation. (A and B)
Supernatant contents of IL-6 and TNF-α. (C-E) IL-6 and TNF-α protein levels. (F) Western blotting of the JAK2/STAT3 signaling and their quantification (G and H).
Data are expressed in the manner of mean ± SD, n = 3. *p < 0.05, **p < 0.01.
L. Xie et al.
International Immunopharmacology 96 (2021) 107639
11
the work reported in this paper.
Acknowledgements
This work was supported by National Natural Science Foundation of
China (Nos. 81673805, 81774100, 81973645 and 81704058), Science
and Technology Planning Project of Guangdong Province (Nos.
2019A1515012063), Guangdong Basic and Applied Basic Research
Fund (Nos. 2019B1515120026, 2019A1515110367 and
2019A1515011560), Project of Administration of Traditional Chinese
Medicine of Guangdong (Nos. 20201392, 20173016), Project of Huizhou science and Technology Bureau (Nos. 2016C0408023)
References
[1] M. Singer, C.S. Deutschman, C.W. Seymour, M. Shankar-Hari, D. Annane, M. Bauer,
R. Bellomo, G.R. Bernard, J.D. Chiche, C.M. Coopersmith, R.S. Hotchkiss, M.
M. Levy, J.C. Marshall, G.S. Martin, S.M. Opal, G.D. Rubenfeld, T. van der Poll, J.
L. Vincent, D.C. Angus, The Third International Consensus Definitions for Sepsis
and Septic Shock (Sepsis-3), JAMA 315 (8) (2016) 801–810.
[2] D.F. Gaieski, J.M. Edwards, M.J. Kallan, B.G. Carr, Benchmarking the incidence
and mortality of severe sepsis in the United States, Crit. Care Med. 41 (5) (2013)
1167–1174.
[3] C. Rhee, R. Dantes, L. Epstein, D.J. Murphy, C.W. Seymour, T.J. Iwashyna, S.
S. Kadri, D.C. Angus, R.L. Danner, A.E. Fiore, J.A. Jernigan, G.S. Martin,
E. Septimus, D.K. Warren, A. Karcz, C. Chan, J.T. Menchaca, R. Wang, S. Gruber,
M. Klompas, Incidence and Trends of Sepsis in US Hospitals Using Clinical vs
Claims Data, 2009–2014, JAMA 318 (13) (2017) 1241–1249.
[4] J.N. Pulido, B. Afessa, M. Masaki, T. Yuasa, S. Gillespie, V. Herasevich, D.R. Brown,
J.K. Oh, Clinical spectrum, frequency, and significance of myocardial dysfunction
in severe sepsis and septic shock, Mayo Clin. Proc. 87 (7) (2012) 620–628.
[5] K.R. Walley, Sepsis-induced myocardial dysfunction, Curr. Opin. Crit. Care 24 (4)
(2018) 292–299.
[6] H. Piotrowska, M. Kucinska, M. Murias, Biological activity of piceatannol: leaving
the shadow of resveratrol, Mutat. Res. 750 (1) (2012) 60–82.
[7] W. Wang, R. Yang, H. Yao, Y. Wu, W. Pan, A.-Q. Jia, Inhibiting the formation of
advanced glycation end-products by three stilbenes and the identification of their
adducts, Food Chem. 295 (2019) 10–15.
[8] M. Boccellino, M. Donniacuo, F. Bruno, B. Rinaldi, L. Quagliuolo, M. Ambruosi,
S. Pace, M. De Rosa, A. Olgac, E. Banoglu, N. Alessio, A. Massa, H. Kahn, O. Werz,
A. Fiorentino, R. Filosa, Protective effect of piceatannol and bioactive stilbene
derivatives against hypoxia-induced toxicity in H9c2 cardiomyocytes and
structural elucidation as 5-LOX inhibitors, Eur. J. Med. Chem. 180 (2019)
637–647.
[9] C. Ellermann, J. Wolfes, S. Kochhauser, D.G. Dechering, F. Reinke, K. Wasmer,
L. Eckardt, G. Frommeyer, Divergent antiarrhythmic effects of resveratrol and
piceatannol in a whole-heart model of long QT syndrome, Int. J. Cardiol. 243
(2017) 233–238.
[10] M. Fritzenwanger, K. Meusel, M. Foerster, F. Kuethe, A. Krack, H.R. Figulla,
Cardiotrophin-1 induces interleukin-6 synthesis in human umbilical vein
endothelial cells, Cytokine 36 (3–4) (2006) 101–106.
[11] D.M. Schwartz, Y. Kanno, A. Villarino, M. Ward, M. Gadina, J.J. O’Shea, JAK
inhibition as a therapeutic strategy for immune and inflammatory diseases, Nat.
Rev. Drug Discov. 16 (12) (2017) 843–862.
[12] J.D. Clark, M.E. Flanagan, J.B. Telliez, Discovery and development of Janus kinase
(JAK) inhibitors for inflammatory diseases, J. Med. Chem. 57 (12) (2014)
5023–5038.
[13] A. Matsukawa, STAT proteins in innate immunity during sepsis: lessons from gene
knockout mice, Acta Med. Okayama 61 (5) (2007) 239–245.
[14] G. Pena, B. Cai, E.A. Deitch, L. Ulloa, JAK2 inhibition prevents innate immune
responses and rescues animals from sepsis, J. Mol. Med. (Berl.) 88 (8) (2010)
851–859.
[15] G. Heusch, J. Musiolik, N. Gedik, A. Skyschally, Mitochondrial STAT3 activation
and cardioprotection by ischemic postconditioning in pigs with regional
myocardial ischemia/reperfusion, Circ. Res. 109 (11) (2011) 1302–1308.
[16] Y. Yang, W. Duan, Z. Jin, W. Yi, J. Yan, S. Zhang, N. Wang, Z. Liang, Y. Li, W. Chen,
D. Yi, S. Yu, JAK2/STAT3 activation by melatonin attenuates the mitochondrial
oxidative damage induced by myocardial ischemia/reperfusion injury, J. Pineal
Res. 55 (3) (2013) 275–286.
[17] S. Zhao, M. Yang, W. Zhou, B. Zhang, Z. Cheng, J. Huang, M. Zhang, Z. Wang,
R. Wang, Z. Chen, J. Zhu, H. Li, Kinetic and high-throughput profiling of epigenetic
interactions by 3D-carbene chip-based surface plasmon resonance imaging
technology, Proc. Natl. Acad. Sci. USA 114 (35) (2017) E7245–E7254.
[18] Y. Wang, C. Wang, Z. Cheng, D. Zhang, S. Li, L. Song, W. Zhou, M. Yang, Z. Wang,
Z. Zheng, B. Han, C. Wang, Y. Yang, J. Zhu, SPRi determination of inter-peptide
interaction by using 3D supramolecular co-assembly polyrotaxane film, Biosens.
Bioelectron. 66 (2015) 338–344.
[19] C. Boozer, G. Kim, S. Cong, H. Guan, T. Londergan, Looking towards label-free
biomolecular interaction analysis in a high-throughput format: a review of new
surface plasmon resonance technologies, Curr. Opin. Biotechnol. 17 (4) (2006)
400–405.
[20] A.K. Anders, M.J. Call, M.S. Schulze, K.D. Fowler, D.A. Schubert, N.P. Seth, E.
J. Sundberg, K.W. Wucherpfennig, HLA-DM captures partially empty HLA-DR
molecules for catalyzed removal of peptide, Nat. Immunol. 12 (1) (2011) 54–61.
[21] L. Dejager, I. Pinheiro, E. Dejonckheere, C. Libert, Cecal ligation and puncture: the
gold standard model for polymicrobial sepsis? Trends Microbiol. 19 (4) (2011)
198–208.
[22] N. Hadi, N.G. Yousif, F.G. Al-amran, N.K. Huntei, B.I. Mohammad, S.J. Ali, Vitamin
E and telmisartan attenuates doxorubicin induced cardiac injury in rat through
down regulation of inflammatory response, BMC Cardiovasc. Disord. 12 (2012) 63.
[23] B. Wei, W.W. Li, J. Ji, Q.H. Hu, H. Ji, The cardioprotective effect of sodium
tanshinone IIA sulfonate and the optimizing of therapeutic time window in
myocardial ischemia/reperfusion injury in rats, Atherosclerosis 235 (2) (2014)
318–327.
[24] T. Chen, R. Wang, W. Jiang, H. Wang, A. Xu, G. Lu, Y. Ren, Y. Xu, Y. Song, S. Yong,
H. Ji, Z. Ma, Protective Effect of Astragaloside IV Against Paraquat-Induced Lung
Injury in Mice by Suppressing Rho Signaling, Inflammation 39 (1) (2016) 483–492.
[25] C.C. Chou, P.C. Chang, M.S. Wen, H.L. Lee, H.T. Wo, S.J. Yeh, D. Wu, Piceatannol
facilitates conduction block and ventricular fibrillation induction in ischemiareperfused rabbit hearts with pacing-induced heart failure, Int. J. Cardiol. 171 (2)
(2014) 250–258.
[26] J. Soong, N. Soni, Sepsis: recognition and treatment, Clin. Med. (Lond.) 12 (3)
(2012) 276–280.
[27] M. Bahador, A.S. Cross, From therapy to experimental model: a hundred years of
endotoxin administration to human subjects, J. Endotoxin. Res. 13 (5) (2007)
251–279.
[28] S. Alvarez, T. Vico, V. Vanasco, Cardiac dysfunction, mitochondrial architecture,
energy production, and inflammatory pathways: Interrelated aspects in
endotoxemia and sepsis, Int. J. Biochem. Cell Biol. 81 (Pt B) (2016) 307–314.
[29] J. Chen, J. Lai, L. Yang, G. Ruan, S. Chaugai, Q. Ning, C. Chen, D.W. Wang,
Trimetazidine prevents macrophage-mediated septic myocardial dysfunction via
activation of the histone deacetylase sirtuin 1, Br. J. Pharmacol. 173 (3) (2016)
545–561.
[30] J.E. Parrillo, C. Burch, J.H. Shelhamer, M.M. Parker, C. Natanson, W. Schuette,
A circulating myocardial depressant substance in humans with septic shock. Septic
shock patients with a reduced ejection fraction have a circulating factor that
depresses in vitro myocardial cell performance, J. Clin. Invest. 76 (4) (1985)
1539–1553.
[31] M. Nian, P. Lee, N. Khaper, P. Liu, Inflammatory cytokines and postmyocardial
infarction remodeling, Circ. Res. 94 (12) (2004) 1543–1553.
[32] Z. Liu, L. Gan, Z. Zhou, W. Jin, C. Sun, SOCS3 promotes inflammation and
apoptosis via inhibiting JAK2/STAT3 signaling pathway in 3T3-L1 adipocyte,
Immunobiology 220 (8) (2015) 947–953.
[33] D. Guo, J.R. Li, Y. Wang, L.S. Lei, C.L. Yu, N.N. Chen, Cyclovirobuxinum D
suppresses lipopolysaccharide-induced inflammatory responses in murine
macrophages in vitro by blocking JAK-STAT signaling pathway, Acta Pharmacol.
Sin. 35 (6) (2014) 770–778.
[34] L. Samavati, R. Rastogi, W. Du, M. Hüttemann, A. Fite, L. Franchi, STAT3 tyrosine
phosphorylation is critical for interleukin 1 beta and interleukin-6 production in
response to lipopolysaccharide and live bacteria, Mol. Immunol. 46 (8–9) (2009)
1867–1877.
[35] C. Ma, Y. Wang, L. Dong, M. Li, W. Cai, Anti-inflammatory effect of resveratrol
through the suppression of NF-κB and JAK/STAT signaling pathways, Acta
Biochim. Biophys. Sin. (Shanghai) 47 (3) (2015) 207–213.
[36] X.-B. Gu, X.-J. Yang, Z. Hua, Z.-H. Lu, B. Zhang, Y.-F. Zhu, H.-Y. Wu, Y.-M. Jiang,
H.-K. Chen, H. Pei, Effect of oxymatrine on specific cytotoxic T lymphocyte surface
programmed death receptor-1 expression in patients with chronic hepatitis B, Chin.
Med. J. 125 (8) (2012) 1434–1438.
[37] M. Zhang, X. Wang, X. Wang, X. Hou, P. Teng, Y. Jiang, L. Zhang, X. Yang, J. Tian,
G. Li, J. Cao, H. Xu, Y. Li, Y. Wang, Oxymatrine protects against myocardial injury
via inhibition of JAK2/STAT3 signaling in rat septic shock, Mol. Med. Rep. 7 (4)
(2013) 1293–1299. Tyrphostin B42.
[38] S. Zhang, X. Liu, S. Goldstein, Y. Li, J. Ge, B. He, X. Fei, Z. Wang, G. Ruiz, Role of
the JAK/STAT signaling pathway in the pathogenesis of acute myocardial
infarction in rats and its effect on NF-κB expression, Mol. Med. Rep. 7 (1) (2013)
93–98.
[39] N. Meydan, T. Grunberger, H. Dadi, M. Shahar, E. Arpaia, Z. Lapidot, J.S. Leeder,
M. Freedman, A. Cohen, A. Gazit, A. Levitzki, C.M. Roifman, Inhibition of acute
lymphoblastic leukaemia by a Jak-2 inhibitor, Nature 379 (6566) (1996) 645–648.
[40] S. Rashid, N. Bibi, Z. Parveen, S. Shafique, Inhibition of Janus kinases by tyrosine
phosphorylation inhibitor, Tyrphostin AG-490, J. Biomol. Struct. Dyn. 33 (11)
(2015) 2368–2379.
[41] S.H. Yang, D.B. Khadka, S.H. Cho, H.K. Ju, K.Y. Lee, H.J. Han, K.T. Lee, W.J. Cho,
Virtual screening and synthesis of quinazolines as novel JAK2 inhibitors, Bioorg.
Med. Chem. 19 (2) (2011) 968–977.
[42] I.S. Lucet, E. Fantino, M. Styles, R. Bamert, O. Patel, S.E. Broughton, M. Walter, C.
J. Burns, H. Treutlein, A.F. Wilks, J. Rossjohn, The structural basis of Janus kinase
2 inhibition by a potent and specific pan-Janus kinase inhibitor, Blood 107 (1)
(2006) 176–183.
[43] C. Zhao, D.B. Khadka, W.J. Cho, Insights into the Structural Features Essential for
JAK2 Inhibition and Selectivity, Curr. Med. Chem. 23 (13) (2016) 1331–1355.
[44] Y. Hitoshi, N. Lin, D.G. Payan, V. Markovtsov, The current status and the future of
JAK2 inhibitors for the treatment of myeloproliferative diseases, Int. J. Hematol.
91 (2) (2010) 189–200.
L. Xie et al.