Insertion of these pumps into the plasma membrane is also used to counteract metabolic acidification of the cytosol in neutrophils (Nanda et al., 1996). vATPase may be even more active in the plasma membrane than in synaptic Selleck BGB324 vesicle membranes, because H+ import into vesicles generates a large luminal [H+] (pH ∼5.5) and membrane

potential (∼100 mV, positive inside), which oppose further H+ transport (Grabe and Oster, 2001). Upon exocytosis, both release of H+ (already within vesicles) and subsequent extrusion of H+ by vATPase would be expected to acidify the synaptic cleft. In photoreceptor and bipolar cells, suppression of presynaptic Ca2+ current and of transmitter release were attributed to transient acidification of the synaptic cleft (0.1–0.2 pH units; DeVries, 2001 and Palmer et al., 2003). This transient cleft acidification has been estimated to dissipate rapidly, with a time constant of <0.2 s. This rate would be expected to be Aurora Kinase inhibitor even faster at the neuromuscular junction, where the synaptic cleft is ∼3× wider than in CNS synapses (Attwell and Iles, 1979). In this study, H+ extrusion by vATPase decayed with a time constant of ∼40–200 s (estimated from the decay of the alkalinizing component, Figure 4), and thus far outlasted the estimated cleft acidification. Thus, any transient cleft acidification

at the neuromuscular junction is likely dominated by rapid deposition and diffusional dissipation of the acidic vesicular

contents, rather than by H+ extrusion by vATPase. For the stimulus trains applied here (200–1000 stimuli at 50 Hz) the half-time of decay of the poststimulation Hydrolase alkalinization of motor terminal cytosol ranged from 30–150 s. This range is consistent with those reported for the half-time of endocytosis measured in mouse motor terminals (stimulated at 30–100 Hz) using other fluorescence-based techniques, including styryl dyes (∼35 s, Zefirov et al., 2009) and synaptopHluorin (10–150 s, Tabares et al., 2007; ∼30 s, Wyatt and Balice-Gordon, 2008). Rates of endocytosis measured using these other techniques became slower as the length of the stimulation train increased (Wu and Betz, 1996 and Tabares et al., 2007). In this study, the half-time of decay of the poststimulation alkalinization also increased with increasing stimulation and was prolonged by application of dynasore, an inhibitor of clathrin-mediated endocytosis. Taken together, these observations suggest that the likely mechanism of recovery of cytosolic pH from stimulation-induced alkalinization is endocytosis of vATPase from the plasma membrane. If so, then retrieval of vATPase from the plasma membrane is important not only for reincorporation of this ATPase into synaptic vesicles, but also for returning cytosolic pH to prestimulation values.

These experiments suggest the DISC1 A83V, R264Q, and L607F variants are not able to function similarly to WT-DISC1 in the regulation of neural progenitor proliferation. We then directly addressed if the changes

in BrdU labeling were due to alterations in the numbers of progenitors exiting the cell cycle and prematurely differentiation. First, we performed the cell cycle exit assay in utero whereby electroporated brain sections were stained for GFP, BrdU, and Ki67. To assess the cell cycle exit index, we counted the percentage of GFP/BrdU double-positive cells that were negative for Ki67, Using this protocol, we found that overexpression of WT-DISC1 was able to rescue the increased cell cycle exit mediated by DISC1 shRNA (Figure 3B). Upon comparison to the DISC1 variants, we found that the A83V, R264, and L607F check details variants all were not able to rescue similar to WT-DISC1 and neural progenitor cells continued to prematurely exit the cell cycle.

However, the S704C variant was able to rescue the DISC1-shRNA-mediated increase in cell cycle exit (Figure 3B), in good agreement with the neural progenitor proliferation data in Figure 3A. We extended these experiments to determine whether the changes in cell cycle exit led to alterations in neuronal differentiation. Electroporated brain sections were costained with GFP and Tuj1 to visualize neurons. We determined that selleckchem the increase in the number

of double-positive GFP/Tuj1 cells due to DISC1 shRNA was rescued when coexpressed with human WT-DISC1 (Figure 3C). In this assay, we observed that the A83V, R264Q, and L607F variants all did not increase the number of double-positive GFP/Tuj1 cells, while the S704C variant indeed functioned similar to WT-DISC1 and rescued similarly (Figure 3C). Together these data suggest that the A83V, R264Q, and L607F DISC1 variants do not function similar to WT-DISC1 or S704C in the regulation of neural progenitor proliferation. To determine whether the 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase DISC1 variants possessed dominant-negative activity in the presence of endogenous mouse DISC1, we performed the in utero electroporation and only overexpressed GFP, WT-DISC1, or the different variants. Staining for BrdU and GFP revealed that overexpression of human WT-DISC1 resulted in a significant increase in the percentage of cells double positive for GFP and BrdU demonstrating that WT-DISC1 expression alone increases the number of dividing neural progenitor cells (Figure S2A). Comparison to the DISC1 variants revealed that the S704C variant similarly increased the number of cycling cells as WT-DISC1. However, the A83V and L607F variant conditions revealed statistically similar numbers of GFP/BrdU-positive cells as GFP controls.

Figure 7J shows such an example

with recordings from an L5 MN in an induced Vglut2-KO animal in which the cell was voltage clamped to −30 mV to enhance the amplitude of the DR L3 evoked compound IPSC (trace 1). Stimulation of L5 DR evoked a short latency EPSC (trace 2). When the DR L3 stimulation was preceded by DR L5 stimulation, there was a small but clear reduction of the DR L3-evoked compound IPSC (trace 2+1). Similar findings were seen in two L5 MNs from wild-type mice and two other L5 MNs from induced this website Vglut2-KO mice with an average reduction of the IPSC by 34% ± 14%. Together, these experiments show that the reciprocal RC and Ia-IN pathways are present and functional in wild-type and Vglut2-KO E18.5 mice. Having confirmed that the RC and rIa-IN pathways are present in mice, including the Vglut2-KOs, we directly tested whether components of this network could be the source of the rhythm and flexor-extensor alternation. Given that RCs inhibit Ia-INs, the rhythm should be blocked in Vglut2-KOs by stimulating the ventral root if reciprocal connectivity between flexor- and extensor-related Ia-INs is the Compound C mouse source of the rhythm and of the alternating activity between flexor and extensors (Figure 8A; Hultborn et al., 1976 and Jordan, 1983). Prolonged stimulation

of the VR (with the same stimulation strength as needed to inhibit the reciprocal Ia pathway; Figure 7) blocked, or strongly attenuated, the ongoing rhythm and the PIK-5 rhythmic oscillations occurring in MNs of Vglut2-KO mice (Figures 8B and 8G; n = 5). This effect was seen when stimulating either L3 or L4 ventral roots (at the same stimulation strength needed to block the reflex) while recording from L2 and L5 (Figure 7G). This effect was blocked by nicotinic receptor blockers (Figure 8C; n = 3). A similar effect was seen in induced Vglut2-KO mice (Figures 8D

and 8G; n = 5). In contrast, prolonged stimulation of the ventral roots sped up the rhythm in control mice (Figures 8E and 8F; n = 10), similar to what has been shown before for the disinhibited rhythm in wild-type mice (Bonnot et al., 2009). Short (1–1.5 s) trains of stimulation of the L4 VRs in Vglut2-KO mice delivered late in the L2 bursting phase caused phase-advance of the next L2 burst with permanent phase shifts of the rhythm (Figure 8H; n = 8 trials in two animals). Similar duration trains delivered in the early phase of the L2 bursts had no effects (n = 12 trials in two animals). Such resetting of the rhythm in a phase-dependent way is indicative of synaptic interaction with the rhythm-generating network (Hultborn et al., 1998). To test whether RC rhythmic activity was needed for network activity in Vglut2-KO mice, we tested the effect of blocking or reducing the MN-to-RC drive with nicotinic blockers on drug-evoked rhythmic activity.

The directional preference is the same for all small regions within the receptive field of the cell; a ganglion cell with a receptive field 500 μm in diameter can discriminate 40 μm movements anywhere within its receptive field (Figure 7). This “local subunit,” is a critical property because it distinguishes this discrimination

from a trivial form of direction selectivity that can be predicted simply from the presence of adjacent ON and OFF regions. It is direction per se that the cell detects, not any simple spatial pattern of excitatory and inhibitory zones. The search for a mechanism settled eventually on the starburst amacrine cell. Critically, Ibrutinib purchase the starburst cells have enormously overlapping dendritic arbors (Tauchi and Masland, 1984). The Alectinib nmr starburst cells do not tile the retina; they shingle

the retina, like roofing shingles, and it was suggested that the reason for their apparent redundancy of coverage was to create the local subunit of the DS receptive field (Masland et al., 1984). In 1988, Vaney and Young proposed what turned out to be the correct mechanism of direction selectivity (Figure 7). They suggested that (1) individual sectors of the starburst dendritic arbor act as independent units, (2) dendritic sectors of the starburst cell pointing in a single direction selectively synapse upon any individual DS ganglion cell, and (3) these sectors are individually

direction selective, creating a directional input to the ganglion (Vaney, 1991; Vaney and Young, 1988). A direct test of this idea came from paired recordings between a DS cell and an overlapping CYTH4 starburst cell (Fried et al., 2002). As predicted, stimulation of a null-side starburst cell produced a GABAergic inhibition of the cell, while stimulation of starburst cells at other locations produced only a mild excitation (Lee and Zhou, 2006). At about the same time, two photon Ca2+ imaging showed that the sectors of a starburst cell are indeed functionally isolated units, and that they are directionally polarized in their responses, with greater Ca2+ influx resulting from stimulus movement outward (away from the soma) than inward (Euler et al., 2002). The coup de grace was provided by Briggman et al. (2011), who used high-throughput electron microscopic reconstruction (see below) to confirm that starburst cells pointing in the null direction selectively contact the DS ganglion cell. This work is discussed in a definitive recent review (Vaney et al., 2012). Because inputs from bipolar and amacrine cells combine, the number of functional types of ganglion cell exceeds the number of types of bipolar cell (Taylor and Smith, 2011).

Free-floating sections were washed in PBS, incubated with PBS containing 0.25% Triton X-100 and 5% FBS for 1hr and stained overnight with primary antibodies. Following washes, sections were incubated with secondary antibodies for 2 hr, washed, mounted on glass slides and coverslipped. For antibody details, see Supplemental Experimental Procedures. For quantitative

RT-PCR analyses of pooled cultured cells, RNA was isolated using the RNAqueous Kit (Applied Biosystems), treated with DNase (Applied Biosystems), and reverse transcribed with Superscript III (Invitrogen). mRNA levels were selleck screening library quantified by real-time PCR assay using the Applied Biosystems 7900HT Fast real-time PCR system and RQ analysis software. For quantitative RT-PCR analyses of single cells, cytoplasm from individual cells was aspirated with a patch pipette, and mRNA levels were measured in the cytoplasm using the Fluidigm Biomark dynamic array system as described (Pang et al., 2011). For all quantitative RT-PCR assays, titrations of total human

brain RNA were included in each experiment, and only primers that demonstrated a linear amplification with R2 values of > 0.98 were included (see Supplemental Information and Table S1 for details). Oligonucleotides containing the human Munc18-1 shRNA sequence (GGCACAGATGCTGAGGGAGAG) were cloned into the XhoI/XbaI cloning site downstream this website of the human H1 promoter in the L309-mCherry lentiviral vector (Yang et al., 2011). Lentiviruses for control (no shRNA) and the Munc18-1 KD were prepared as described above and used to infect H1-iN cells 5 days after doxycycline addition. iN cells were analyzed at 3 weeks after Ngn2 induction by determining the KD efficacy using RT-PCR and by electrophysiology. Ca2+ imaging experiments were performed with iN cells that were infected with a lentivirus expressing GCaMP6M on day 3 after induction, cocultured with mouse cortical neurons at day 6 after induction, and analyzed at day 21. See Supplemental Information for details. H1 cells were

coinfected with viruses expressing Ngn2 and oChiEF-tdTomato on day 1, and mouse cortical neurons were added for coculture on day 3. iN cells Bone morphogenetic protein 1 were analyzed at day 21 as described in detail in the Supplemental Experimental Procedures. H1-derived iN cells were dissociated using Enzyme-Free Cell Dissociation Buffer (GIBCO) 7 days after infection (i.e., on day 6) without coculture of astrocytes, and 105 cells were unilaterally injected under hypothermia-induced anesthesia into the striatum of postnatal day 2 NOD-SCID; IL2Rγ knockout mice. Mice were processed for immunocytochemistry or slice electrophysiology 6 weeks after transplantation. Electrophysiology of cultured iN cells was performed essentially as described (Maximov and Südhof, 2005; Pang et al., 2011). Stimulus artifacts for evoked synaptic responses were removed for graphic representation.

The authors acknowledge NIMH for grants MH51570 and MH71702 that supported this work. “
“Precise neural circuits are the substrate for cognition, perception, and behavior. In the mammalian nervous system, many neural circuits transition from an imprecise to a refined state to achieve their mature connectivity patterns. The refinement process involves

restructuring of axons, dendrites, and synapses such that certain connections are maintained and others are lost. Studies of both CNS and PNS circuits have shown that neural activity can impact circuit refinement through competitive mechanisms in which stronger, more active connections are maintained and weaker, less active connections http://www.selleckchem.com/CDK.html are eliminated (Katz and Shatz, 1996 and Sanes and Lichtman, 1999). A long-standing model for probing the mechanisms underlying activity-mediated CNS circuit refinement is the formation of segregated right and left eye axonal projections to the dorsal lateral geniculate nucleus (dLGN). In mammals, axons from the two eyes initially overlap in the dLGN; subsequently, they segregate into nonoverlapping eye-specific territories Tofacitinib chemical structure (Huberman et al., 2008a and Shatz and Sretavan, 1986). Eye-specific segregation involves competition between left and right eye axons that is mediated by spontaneous retinal activity (Penn et al., 1998 and Shatz and Sretavan, 1986). If spontaneous activity

is perturbed in both eyes or blocked intracranially (Penn et al., 1998, Rossi et al., 2001 and Shatz and Stryker, 1988; but see Cook et al., 1999), eye-specific Interleukin-11 receptor segregation fails to occur. By contrast, if activity is disrupted or increased in one eye, axons from the less active eye lose territory to axons from the more active eye (Koch and Ullian, 2010, Penn et al., 1998 and Stellwagen and Shatz, 2002). Thus, the prevailing model is that the relative activity of RGCs in the two eyes dictates which retinogeniculate connections are maintained and which are lost and that this competition is waged through the capacity of RGC axons to drive synaptic plasticity at

RGC-dLGN synapses (Butts et al., 2007 and Ziburkus et al., 2009). To date, however, few studies have manipulated retino-dLGN transmission in vivo; thus the direct roles played by synaptic transmission in eye-specific refinement await determination. Here we use a mouse genetic strategy to selectively reduce glutamatergic transmission in the developing ipsilateral retinogeniculate pathway in vivo. By biasing binocular competition in favor of the axons from the contralateral eye, we were able to directly investigate the role of synaptic competition in activity-dependent neural circuit refinement. To investigate the role of synaptic transmission in visual circuit refinement, we wanted to selectively alter synaptic glutamate release from one population of competing RGC axons.

Although already related in snakes infected with C. serpentis ( Godshalk et al., 1986 and Carmel and Groves,

1993), midbody swelling was not observed, as reported by Cranfield and Graczyk (1994). The mortality observed is common in snakes that are chronically infected with C. serpentis ( Godshalk et al., 1986, Carmel and Groves, 1993 and O’Donoghue, 1995). It is not possible to say that C. serpentis is the primary cause of the snakes’ death because research concerning other etiological agents was not performed. Therefore, the presence of concomitant infections cannot be ruled out ( Brownstein et al., 1977). During the course of cryptosporidiosis in snakes, intermittence and variation in the number of oocysts shed in fecal samples are common (Graczyk et al., 1996b, Ipilimumab cost Karasawa et al., 2002 and Sevá et al., 2011), even in symptomatic animals. Table 1 and Table 2 indicate that most animals presented intermittent shedding of various quantities

of oocysts in feces. Molecular identification of the species of Cryptosporidium present in the snakes’ fecal samples was conducted at the beginning and end of the experiment. selleck screening library However, this analysis was not performed in the rodents that were fed to the snakes, which makes it impossible to say with certainty that the oocysts observed by microscopy were not from the species of rodents and eliminated passively. However, all the snakes were demonstrably infected with C. serpentis, and the snakes that were used for serum collection without antibodies against Cryptosporidium spp. were negative when examined by microscopy and nested PCR, despite having been fed with rodents from the same vivarium. The snakes developed a humoral immune response against C. serpentis, and antibodies were detected in 86 of 126 serum samples from animals that were proven to be positive for C. serpentis. There was also

a fluctuation in antibody titer and, in some cases, a lack of humoral response in some animals. It was not possible to determine the causes of fluctuation in the level of antibodies against C. serpentis due to lack of information regarding the immunological response against gastric cryptosporidiosis, particularly in snakes. Some reports indicate that there is seasonal variations in reptiles’ immune response, either as inate or adaptive (humoral Ketanserin and cellular), as described in turtles ( Zimmerman et al., 2010) and snakes ( El Ridi et al., 1981 and Kobolkuti et al., 2012). Zapata et al. (1992) also related alterations in the immune system of amphibians, reptiles, and fish to environmental factors, including photoperiod, temperature, season, and species. However, the variations in the level of antibodies observed in this experiment do not follow any pattern related to the seasons, and the animals were kept in a controlled temperature environment. Another factor that can be related to variation in the level of antibodies is stress in captivity, which predisposes snakes to infectious diseases (Grego, 2000).

As previously reported, a considerable

fraction of ectopic Olig2 in transfected COS cells is mislocalized to the cytosol (Sun et al., 2003). The level of ectopic Olig2 generated by COS cell expression vectors is so high that we did not need to use isolated nuclei as a click here source of starting material for our protein preparations and, instead, extracted both nuclear and cytosolic Olig2. For these reasons we are inclined to regard the S81 and S263 phosphorylation events as cytosol-specific artifacts of the COS cell system. Setoguchi and Kondo (2004) have suggested (on the basis of in vitro phosphorylation studies) that AKT-mediated phosphorylation of S30 causes Olig2 to relocalize from the nucleus to the cytosol, where it is subsequently degraded to allow formation of astrocytes from neural progenitor cells. We did not detect any evidence Nutlin-3a mouse of S30 phosphorylation in nuclear extracts

of the neural cell types we studied. However, S30 was detected as a low-confidence phosphorylation site in COS cell extracts. The detection of low levels of phospho S30 in our mass spectroscopy analysis of COS cell Olig2 may have been enabled by the large amounts of cytosolic Olig2 in the COS cell preparations and would thus be consistent with a degradative role of S30, as suggested by Setoguchi and Kondo (2004) (but see below). Critical primary and secondary structural features of proteins are conserved through evolution. Myelinating oligodendrocytes are detected in all vertebrates above the jawless fish. As indicated in Figure S7, the triple serine motif and its flanking amino acid residues are well conserved in Olig2 from human down through zebrafish. In fact, the triple serine motif of Olig2 is nearly as well conserved as the DNA-targeting bHLH motif. The other Nabilone high-confidence phosphorylation site at T43 is likewise well conserved. By contrast

the S30 region of Olig2 (Setoguchi and Kondo, 2004) does not seem to be well conserved. Murine Olig2 and its close structural homolog Olig1 contain a serine/threonine-rich “box” toward the amino-terminal side of the DNA-targeting bHLH domain (Lu et al., 2000, Takebayashi et al., 2000 and Zhou et al., 2000). In murine Olig2 this S/T box is an especially distinctive feature, containing 11 contiguous S or T residues beginning at S77 and ending at S88 (Figure S1). We were somewhat surprised that our mass spectroscopy analysis of endogenous Olig2 detected no evidence of phosphoserine or phosphothreonine residues within this S/T box. DNA sequence analysis reveals that the S/T box diverges rapidly down through phylogeny (in contrast to the triple serine motif). Beginning with chicken and moving downward to Xenopus Olig2, an increasing number of the serines are replaced by alanine residues. In space-filling models, alanine and serine residues are roughly equivalent, suggesting that size rather than phosphorylation potential is the critical structural feature of the S/T box.

trio mutants perturb synapse maturation in a manner similar to loss of miniature events, and activation of Trio or Rac1 can rescue miniature NT mutants. Trio and Rac1 have been implicated in actin dynamics in multiple contexts, including axonal growth cones and synapses ( Ball et al., Onalespib concentration 2010 and Miller et al., 2013), and GTPases can act as spatially confined “switches” inducing local cytoskeletal rearrangements. Interestingly, Trio is also transcriptionally regulated by the synaptotrophic BMP pathway ( Ball et al., 2010) offering a potential molecular “node” to integrate local fine-tuning

of maturation by miniature NT with global synaptic growth regulation. While our data support that Trio and Rac1 mediate the effects of miniature NT on presynaptic neurons, multiple intercellular signaling molecules can interact with Trio ( Miller et al., 2013), requiring further investigation to establish how postsynaptic miniature events interact with this presynaptic pathway. Our studies beg the question of how miniature NT can be differentiated from evoked NT. The effects of miniature NT on

developing synaptic boutons are both specific and localized. In mammalian cultured neurons, it has been suggested that miniature NT can target populations of postsynaptic receptors spatially separated to those activated by evoked neurotransmitter release (Ramirez and Kavalali, 2011). Consistent with this, it has also been directly observed that subpopulations of active zones at Drosophila synapses are specialized for the release of either miniature

or evoked events ( Melom et al., 2013 and Peled et al., 2014). Therefore, miniature and evoked NT selleck chemical may activate spatially distinct postsynaptic signaling mechanisms. An alternative possibility is that differences Resminostat in the release kinetics between evoked and miniature NT could allow postsynaptic mechanisms to detect and differentiate between them. For example, local or global Ca2+ signaling through voltage-gated Ca2+ channels can be distinguished by calmodulin ( Tadross et al., 2008). Unsynchronized activation of glutamate receptors through miniature events could also trigger downstream signaling mechanisms that are not activated by the synchronized activation of receptors by evoked release. In the past, miniature events were often dismissed as synaptic epiphenomena related to the requirement for a high fidelity of synaptic vesicle release during evoked NT (Sutton and Schuman, 2009 and Zucker, 2005). Several studies over the last decade, however, have challenged this view. For example, miniature synaptic vesicle release has recently been found to be regulated by specialized Ca2+ sensors (Walter et al., 2011). mEPSPs can influence the firing rates of cerebellar interneurons, affect synaptic homeostasis, and at elevated levels trigger spiking of hippocampal neurons (Frank et al., 2006, Otsu and Murphy, 2003 and Sutton and Schuman, 2009).

, 2011 and Buzsáki and Wang, 2012). In the olfactory bulb (OB), γ oscillations emerge spontaneously in behaving animals in response to respiration-related rhythmic activity from

the olfactory sensory neurons (Kay et al., 2009). When compared with in vitro or anesthetized models, γ oscillations collected in awake animals exhibit three unique features: (1) they are more prominent and emerge in absence of odor stimulation (Li et al., 2012); (2) they comprise distinct subbands (Kay, 2003); and (3) they display a complex spatiotemporal dynamic in response to odor (Martin et al., 2006 and Kay et al., 2009). The divergence between anesthetized and awake results also extends to the strength of olfactory inputs (Vincis et al., 2012) and to the encoding of olfactory information by OB output neurons. In contrast to anesthetized animals, in which firing rate-based representation of odors selleck screening library dominates, odor responses in awake animals are rate invariant and are characterized by temporal changes in spike timing (Rinberg et al., 2006 and Gschwend et al.,

2012). Collectively, these observations call into question the validity of transposing data from in vitro or anesthetized models to the awake status and indicate the need for a comprehensive analysis of the mechanisms that generate γ oscillations in the awake animal. The OB is the first relay of the olfactory system where olfactory information is processed before being conveyed to the cortex. In the OB, sensory neuron axons terminate buy GSK126 in the glomeruli where they form excitatory synapses with output neurons, namely mitral/tufted cells (MCs). Excitatory sensory inputs to MCs trigger glutamate release from their lateral dendrites onto a large population of local axonless interneurons, the granule cells (GCs), which in turn inhibit MCs via dendritic GABA release (Isaacson and Strowbridge, 1998 and Chen et al., 2000). In addition, glutamate release from MC dendrites can Purple acid phosphatases also trigger recurrent excitation via AMPA and NMDA receptors (AMPARs and NMDARs, respectively) (Salin et al., 2001, Aroniadou-Anderjaska et al., 1999 and Isaacson, 1999). The dendrodendritic reciprocal synapse supports recurrent and lateral inhibition between MC

and GC dendrites. Because recurrent and lateral inhibition mediates key steps in sensory processing such as gain control and odor selectivity of MC responses (Tan et al., 2010), dendrodendritic inhibition is crucial for proper odor discrimination (Abraham et al., 2010). In vitro recordings and current-source density analysis in anesthetized rodents have shown that the dendrodendritic reciprocal synapse is also a key player for generating OB γ oscillations (Neville and Haberly, 2003, Lagier et al., 2004, Lagier et al., 2007 and Bathellier et al., 2006). However, these studies have not explored alternative mechanisms such as gap junction coupling between MCs (Schoppa and Westbrook, 2001) or intrinsic interneuron-interneuron networks (Eyre et al., 2008).