2 U DNase (Invitrogen, Brazil) at 37 °C for 5 min, to digest any contaminating DNA, and then heated to 65 °C for 3 min. The RNA was reverse transcribed (RT) in the presence of 1 μM oligo(dT), primer, 4 U Omniscript RTase (Omniscript RT Kit; Qiagen, Mississauga, Canada), 0.5 μM dideoxynucleotide triphosphate (dNTP) mix and 10 U RNase Inhibitor (Invitrogen, Brazil) in a volume of 20 μL at 37 °C for 1 h. The reaction was terminated by incubation at 93 °C for 5 min. The Real-time polymerase chain reaction (PCR) was conducted in a Step One Plus instrument (Applied Biosystems, Foster City, Canada) with AZD2014 ic50 Platinum SYBR Green qPCR SuperMix (Invitrogen, Brazil) and bovine-specific

primers KNG (Initiator sense: TTGGCTGTGTGCATCCCATA and anti-sense: AGGTGGGAATGACTGGTGTTG); B2R (Initiator

sense: TCACCAACATCCTCCTGAACTCT and anti-sense: CGTGGCCTTCCTCTCAGTCT); and B1R (Initiator sense: CTCGACGGCGTCTGAACAC and anti-sense: CGGATGTTCTCTGCCCAGAA). Common thermal cycling parameters (3 min at 95 °C, 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C) were used to amplify each transcript. Melting-curve STAT inhibitor analyses were performed to verify the product identity. Samples were run in duplicate and were expressed relative to cyclophilin as the housekeeping gene. The relative quantification of gene expression across treatments was evaluated using the ddCT method [22]. Briefly, the dCT is calculated as the difference between the Vitamin B12 CT of the investigated gene and the CT of housekeeping gene

in each sample. The ddCT of each investigated gene is calculated as the difference between the dCT in each treated sample and the dCT of the sample with lower gene expression (higher dCT). The fold change in relative mRNA concentrations was calculated using the 2−ddCT formula. Bovine-specific primers were taken from literature or designed using Primer Express Software v3.0 (Applied Biosystems, USA) and synthesized by Invitrogen, Canada. The cross-contamination in granulosa and theca cells were tested by Real-time PCR conform first described [7] and [29]. The activity of a tissue kallikrein-like enzyme was measured on the selective peptide-nitroanilide substrate d-Val-Leu-Arg-paranitroaniline (d-Val-Leu-Arg-pNA, dissolved in ultrapure water to a concentration of 1.5 mM and stored at 4 °C). The method used for measurement of the kallikrein tissue was the same as the previously described [27] one, but with some modifications. The protein content of the follicular fluid was determined by the Bradford method [4], using a standard curve with known concentrations of bovine serum albumin within the absorbance reference. The results of the kallikrein enzyme activity were expressed as nmol of the formed product (p-nitroaniline) by time (in minutes) and also by amount of protein (expressed in mg of protein) of each follicular fluid sample [27].

Here, associations between achieving learning and Extraversion and Openness were negative (−.67, and −.20, respectively), while Conscientiousness was positively related (.24). The exogenous variables accounted for 24.5%, 48.4% and 30.4% in surface, deep, and achieving learning, respectively. The current study tested the associations of the Big Five, TIE and intelligence with learning approaches. Confirming some of our hypotheses (cf. Arteche et al., 2009 and Furnham et al., 2009), TIE

was positively associated with deep and achieving learning and negatively with surface learning. It accounted for about 6% of the variance in achieving and for 22% of the variance in surface learning respectively, while it explained 48% – that is, almost all of its currently explained variance – in deep learning. Conversely, the associations of intelligence GPCR Compound Library and the Big Five with learning approaches were not completely in line with previous findings (Chamorro-Premuzic and Furnham, 2008 and Chamorro-Premuzic and Furnham, 2009). Thus, Extraversion, Openness and Neuroticism were not associated with surface and deep learning, which had a small, negative

relation with intelligence. Achieving learning was the only learning approach that was associated MK-1775 clinical trial with personality traits other than TIE (i.e. Extraversion, Openness and Conscientiousness), and they accounted for 26% of its variance. It appears that an achieving learning relates to a more diverse personality profile than deep and surface learning approaches do. In line with our hypothesis, Agreeableness was not meaningfully associated with any learning approach. Overall, the current results support TIE as a close relative of learning approaches,

suggesting that associations of the Big Five with learning approaches are attenuated by TIE, at least for deep and surface learning. Indeed, TIE is correlated with Openness and Conscientiousness (von Stumm et al., 2011) that were previously found to be related to learning approaches but not here (Chamorro-Premuzic & Furnham, 2009). Our study is limited by its single-wave nature and the lack of a concrete outcome Farnesyltransferase variable (e.g. exam grades). Also, the Wonderlic test may not be an ideal measure of intelligence. Nonetheless, the findings suggest that learning approaches share much of variance with the Big Five and TIE but not enough to dismiss the construct as redundant. Furthermore, learning approaches differ in the extent of variance that was accounted for by personality and intelligence. Specifically, only 25% of the variance in surface learning were accounted for, suggesting that additional variables cause students to invest minimally in their studies, for example the necessity of part-time employment. Finally, this study emphasized the conceptual and empirical overlap of TIE and deep learning, which appear to constitute important determinants of academic achievement (cf. von Stumm et al., 2011).

Zinc deficiency in humans is characterized by a reduction of IL-2 and IFN-γ. A randomized double-blind, placebo-controlled trial of zinc supplementation was conducted in elderly people (Prasad et al., 2007). The zinc supplementation decreased incidence of infections and ex vivo generation of TNF-alpha and plasma oxidative stress markers than in the placebo group. Zinc supplementation was effective in decreasing incidences of infections in the elderly patients with sickle cell disease (Bao et al., 2008) and has beneficial effect on respiratory tract infections

in children (Veverka et al., 2009). Zinc may have a preventive role in some cancers such as colon and prostate and in atherosclerosis inasmuch as chronic inflammation has been implicated in the development of these disorders. Clinical trials have confirmed that the group taking zinc supplements had a shorter mean overall duration of cold and shorter duration of cough. The results CB-839 of zinc supplementation in AIDS are contradictory (Bobat et al., 2005). It has been observed that

only zinc deficient patients would respond to zinc supplementation and zinc sufficient patients may not have any beneficial effects. More studies are needed in this respect. Zinc supplements Y27632 intake together with IFN-alpha was more effective against chronic hepatitis C than therapy with IFN-alpha alone (Takagi et al., 2001). It is also possible that zinc has an antioxidant effect and this may have benefited a few cases of hepatitis. Zinc intake seems also promising to inhibit herpes simplex virus (Kumel et al., 1990) Digestive enzyme and rhinoviruses

(Korant et al., 1974). While one study reported the beneficial effects of zinc supplementation with respect to joint swelling in patients with rheumatoid arthritis, two other studies did not confirm this observation (Overbeck et al., 2008). Preventive effects of zinc supplemention in a group receiving zinc gluconate have shown significantly decreased incidence of infections and ex vivo generation of TNF-alpha and plasma oxidative stress markers with respect to a placebo group (Prasad et al., 2007). The zinc-supplemented group of patients with sickle cell disease had decreased incidences of infection in comparison to the placebo group (Bao et al., 2008). After zinc supplementation, antioxidant power increased. In addition, plasma nitrite and nitrate (NOx), lipid peroxidation products, DNA oxidation products, and soluble vascular cell adhesion molecule-1 (VCAM-1) decreased compared to the placebo group. Since oxidative stress and chronic inflammation may play important causative roles in many chronic diseases, including atherosclerosis, cancers, neurological disorders, and autoimmune diseases, more thorough studies exploring the status of zinc deficiency and supplementation are necessary. Lead has atomic number 82 (symbol Pb) and is one of the heavy metals.

Because TGF-β can induce expression of CD103 in some cells, 14 a potential explanation for the reduced ability of Itgb8 (CD11c-Cre) mice to induce iTregs is that lower CD103+ DC numbers are present in these mice owing to reduced TGF-β activation. However, we found that Itgb8 (CD11c-Cre) mice had comparable numbers of CD103+ DCs in all gut-associated BMN 673 mw lymphoid tissue examined ( Figure 6C). Taken together with our in vitro data, these results strongly indicate that αvβ8-mediated TGF-β activation by specialized intestinal

CD103+ DCs is essential for the induction of tolerogenic Foxp3+ iTregs in the gut. Intestinal CD103+ DCs have emerged as key cells in maintaining gut tolerance, with recent data showing that these cells have the enhanced ability to induce gut-homing receptors on responding T cells15 and convert naïve T cells to immune-suppressive Foxp3+ iTregs.6 and 7 These important functions appear to be due to high expression of the retinal dehydrogenase aldh1a2 in CD103+ intestinal DCs, suggesting they have the capacity to metabolize retinal acid to RA. 6 However, our data now show that CD103+ gut DCs have an enhanced ability to induce iTregs that is independent of RA but completely http://www.selleckchem.com/products/MDV3100.html dependent on TGF-β function. These results strongly suggest that the enhanced ability of CD103+

intestinal DCs to induce iTregs is linked to an increased ability of these cells to produce active TGF-β. Indeed, we directly show for the first time that CD103+ intestinal

DCs are specialized to activate latent TGF-β and that elevated expression of the TGF-β–activating integrin αvβ8 by CD103+ intestinal DCs is responsible for the enhanced ability of these cells to activate latent TGF-β. Importantly, elevated integrin αvβ8-mediated TGF-β activation by CD103+ intestinal DCs is responsible for their increased ability to induce Foxp3+ Tregs both in vitro and in vivo. We have therefore identified a novel molecular pathway by which a specialized gut DC subset activates TGF-β to promote a tolerogenic environment via induction of Foxp3+ iTregs. Many different immune cells produce TGF-β (predominately the isoform TGF-β116) Cisplatin but always noncovalently bound to an N-terminal propeptide (LAP), preventing TGF-β binding to its receptor.8 Hence, TGF-β function is exquisitely regulated at the level of TGF-β activation. Strong evidence in vivo now supports a critical role for integrin receptors in activating latent TGF-β1 via interaction with an RGD integrin binding motif present in the LAP region of the latent complex.17 Our finding that the TGF-β–activating integrin αvβ8 is highly expressed and functionally important on specialized tolerogenic DCs in the intestine correlates with our previous findings that Itgb8 (CD11c-Cre) mice develop severe colitis associated with reduced levels of total Foxp3+ Tregs in the colonic lamina propria.

Also, protein ubiquitination in JNK inhibitor in vitro synapses of rat brains was also studied using this approach [ 28]. Advantages and challenges are also discussed in recent reviews [ 24 and 29]. There are some limitations to this approach in that there is some ambiguity in assigning gly-gly modifications on lysine residues to ubiquitination, as for instance NEDD8 modification also leads to the same tag present on lysine side chains after proteolytic trypsin digestion. To overcome this, other tags on the basis of the detection of LRGG-lysine have been used in MS experiments (Figure 2). However, this approach is not feasible for the detection of protein

modifications with other ubiquitin-like proteins, such as SUMOylation. Recent attempts to overcome this without the need to introduce SUMO C-terminal mutations were reported in which the application of aspartic acid cleavage, caspase, elastase and trypsin digestion protocols were used to generate SUMO tags on lysine residues that can facilitate Selleck SB431542 detection of modifications by SUMO1 and SUMO2/3 [30 and 31]. Such approaches permit the survey of a wider range of ubiquitin and ubiquitin-like modification profiles on proteomes under normal physiological and pathological conditions in the future. Advances in the sensitivity and throughput

of mass spectrometry (MS) based discovery capabilities have continued to spur experiments that are focused on characterising the expression of conjugating (E1/E2/E3s) and deconjugating enzymes (DUBs), but also their interactors and/or substrates. For instance, whole Selleckchem Etoposide cell proteome studies can now provide insight into the turnover and levels of several thousands of cellular proteins in one single experiment [32••, 33 and 34••]. Of particular note is a study reporting on a reference proteomes of 11 cell lines illustrating differences

in the steady state level of a number of proteins [32••]. This is the first time that comprehensive information on the abundance of components of the ubiquitin system is available in different cell types. Interestingly, the abundance of ubiquitin-specific enzymes appears to vary to a great extent as demonstrated for a selection of E3 ligases and DUBs (Figure 3). This information can help to better understand their biological function when combined with functional assays, cell type specificity and regulation. Also, direct co-immunoprecipitation of either E3 ligase components or DUBs directly has given better clues about the enzyme’s function through the discovery of interactors and/or substrates [35, 36 and 37]. However, these approaches have their limitations in terms of the identification of cognate substrates as often direct enzyme-substrate affinities are low.

6%) patients. About 40% of the patients had mediastinal lymph node metastases

at the time of surgery, classified as stage N1 and stage N2 in 43 (28.5%) and 18 (11.9%) patients, respectively. The CDK inhibition study comprised 64 cases of adenocarcinoma (ADC), 35 cases of large cell carcinoma (LCC), and 52 cases of squamous cell carcinoma (SCC) of the lung (Table 1). The median MET CN in tumor tissue was 2.05 (ranged from 0.50 to 7.40) and was not significantly affected by analyzed clinicopathologic variables. With 3.0 copies used as a cutoff in MET CN evaluation, gene copy gain was observed in 28 (18.5%) tumor samples, including 15 cases with 3.0 to 3.99 MET copies per cell and the remaining 13 samples containing from 4.0 to 7.7 copies ( Table 1). In our cohort PD332991 of patients with NSCLC, MET CNG was observed approximately 2.7- and 2.0-fold more frequently in the tumors with increased EGFR and HER2 CN compared to the tumors without the increase (P = .002 and .049 for EGRF and HER2, respectively) and about 2.4-fold more frequently in tumors harboring EGFR mutations compared to tumors with wild-type EGFR (P = .071). However, subgroup analysis for particular tumor histologic types revealed that statistically significant associations between MET CNG and EGFR or HER2 gene alterations occurred only in the ADC group but not in the LCC or SCC group. No associations

between MET CN and KRAS gene mutations or copy gain were found in particular histologic types of cancer ( Table 2). We were unable to determine MET cDNA in 16 analyzed tumor and/or normal lung tissue specimens and these paired samples were excluded from the assay. The MET mRNA level was significantly higher in tumor tissue as compared to unaffected tissue (relative quantity (RQ) geometric mean, 1.76; 95% confidence interval (CI), 1.29-2.40; P < .001). However, with respect to tumor histologic types, a statistically significant alteration was obtained only in ADCs

(RQ geometric mean, 2.14; 95% CI, 1.33-3.45; P < .001). No significant associations between MET mRNA expression and patients’ characteristics were found ( Table 1). Linear regression model revealed a statistically significant link between MET CN and mRNA expression in lung tumor tissue ( Figure 1). Gain of an additional DOCK10 gene copy resulted in 1.51-fold increase in the expression level (95% CI, 1.22-1.87; P < .001). During the follow-up period, 34.4% of the patients showed disease recurrence and most of them (31.8%) died. The median OS was 30 months (ranged from 2 to 86 months), and the DFS was 33 months (ranged from 2 to 85 months). In Kaplan-Meier curve analysis, neither MET CN alterations nor MET mRNA expression level influenced patients’ OS or DFS ( Figure 2, A and B). However, when the analysis was restricted to patients with ADC histology, both DFS and OS were shorter in the cases with an increased MET CN, although only DFS difference was statistically significant (log-rank test, P = .044 and P = .

[email protected] Web: http://phytopath.ca/meetings.shtml *IOBC-WPRS WORKING GROUP, INSECT PATHOGENS AND INSECT PARASITIC NEMATODES 16–20 June Zagreb, CROATIA Contact: R. Bazok E-mail: [email protected] *INTERNATIONAL CLUBROOT WORKSHOP 19–21 June Edmonton, ALB, CANADA Info: K. TurkingtonE-mail: [email protected] *16th EUROPEAN WEED RESEARCH SOCIETY SYMPOSIUM 24–27 June Samsun, TURKEY Info: [email protected] Info: http://tinyurl.com/7vpwrv3 *NORTH AMERICAN INVASIVE PLANT ECOLOGY

AND MANAGEMENT SHORT COURSE 25–27 June North Platte, NE, USA Info: S. YoungE-mail: [email protected] Web: http://ipscourse.unl.edu/ *INTERNATIONAL ORGANISATION OF CITRUS VIROLOGISTS CONFERENCE 28 July–02 August Kruger National Park, SOUTH Everolimus research buy AFRICA Contact: G. Pietersen E-mail: [email protected] AMERICAN PHYTOPATHOLOGICAL SOCIETY ANNUAL MEETING 10–14 August Providence, RI, USA Info: APS, 3340 Pilot Knob Rd., St. Paul, MN 55121, USAFax: 1-651-454-0755 Voice: 1-651-454-3848 E-mail: [email protected] Web: www.apsnet.org *9th INTERNATIONAL WORKING GROUP ON PLANT VIRUSES WITH FUNGAL VECTORS 19–22 August Obihiro, Hokkaido, JAPAN Contact: T. Maoka, E-mail: [email protected]

*150th ENTOMOLOGICAL SOCIETY OF ONTARIO ANNUAL MEETING, jointly with the ENTOMOLOGICAL SOCIETY OF CANADA 18–24 October Guelph, ONT, CANADA Info: N. McKenzie BMS-754807 molecular weight E-mail: [email protected] Web: http://www.entsocont.ca Full-size table Table options View in workspace Download as CSV “
“Feuerstien JD, Najarian R, Cheifetz AS, et al. Hickam’s dictum in a patient with diarrhea. Gastroenterology 2013;145:942, 1165. In the above article, the first author’s surname should be correctly spelled as Feuerstein. “
“As of July 2011, Dr. Charlie click here Richies retired as Editor-in-Chief of Crop Protection after serving in this capacity since 2008.

On behalf of the Editors and Elsevier we would like to extend our warm appreciation to Charlie for his contributions to the Journal. We are pleased to announce that Dr. Jens C. Streibig, Professor, Department of Agriculture and Ecology, Crop Science, University of Copenhagen, Denmark, has joined the team of Editors, as of 1st September 2011. A native of Denmark, Dr. Jens Streibig received M.S. degrees in Crop Science and a Ph.D. in Agricultural Botany from the Royal Veterinary and Agricultural University, Denmark (KVL). After post-doctoral research and a position as an associate professor at KVL he was awarded his D.Sc. degree and became a professor in Weed Science at KVL. He is an Honorary Member of the Weed Science Society of America, and has served as an Editor of the journal Weed Research. Dr. Streibig conducts research in herbicides selectivity, pesticide mixtures and pesticide use, action and ecotoxicology. He has published in the above research areas and has co-jointly with a statistician developed a dose-response curve package for the programme and environment R. We are sure you will all join us in welcoming Dr.

As a negative control, other cuttings were treated for 8 h with Hoagland’s solution alone and, as a vehicle control, with Hoagland’s solution (4 h), as well as with Tween 20 (20%,

4 h). After each treatment, the cuttings were allowed to recover for 24 h in Hoagland’s solution; the young inflorescences were collected and fixed in a solution of acetic acid/ethanol (1:3). At least 10 cuttings were scored, and only preparations showing early tetrads were counted. The number of micronuclei in 300 tetrads per slide was counted at a magnification of × 400, and the results are expressed as the percentage GABA inhibition of micronuclei. Six-week-old Balb/c male mice were maintained in a temperature- and humidity-controlled environment (22 ± 2 °C; 55 ± 10% humidity), on a 12/12 h light/dark cycle. Before the experiments, the animals were acclimatized for 1 week, during which

time they had free access to a commercial diet (Purina®) and water. The study was approved by the Animal Research Ethics Committee of the São Paulo State University, College of Pharmaceutical Sciences (res. CEP/FCF/CAr no. 01/2006) Mice were randomly assigned to 9 groups of 8 animals each. Group 1 (negative control) mice received only drinking water (0.6 ml/day by gavage) for 2 weeks before treatment with 0.9% saline solution by i.p. injection. Group 2 (positive control) mice also received only drinking water for 2 weeks but were treated on day 15 with i.p. injections of TSP at 3.75 mg/kg body see more weight (BW). Group 3 mice received 0.6 ml Tween 20 (20%) or Tween 80 (6%) by gavage, for 2 weeks, and were treated CAL-101 clinical trial on day 15 with TSP (3.75 mg/kg BW, i.p. The mice in groups 4–9 were treated by gavage (0.6 ml/day) with solutions of ethanolic extract of C. sylvestris (3.9, 7.5, and 15.0 mg/kg BW; groups 4, 5, and 6, respectively) and casearin X (0.3, 0.6, and 1.2 mg/kg BW; groups 7, 8, and 9, respectively) for 2 weeks, all receiving i.p. injections of TSP (3.75 mg/kg BW) on day 15. Mouse bone marrow was collected 24 h after TSP injection. The micronucleus test was carried out as described by Schmid (1975). All slides

were stained with May–Grunwald Giemsa and coded to avoid observer bias. For each experimental result, 1000 polychromatic erythrocytes (PCEs, immature erythrocytes) were scored in order to determine the percentage of micronucleated PCEs. To assess cytotoxicity, the ratio of PCEs to normochromatic erythrocytes (NCEs, mature erythrocytes) was determined in 200 cells. For the comet assay of mouse blood cells, the experimental design was the same as was that for the micronucleus test in mouse bone marrow. Peripheral blood was collected in heparinized capillary vials and kept on ice until use. In brief, 20 μl of blood was homogenized with low-melting-point agarose, spread on a microscope slide pre-coated with normal-melting-point agarose, and coverslipped.

Inter-rater agreement for these ratings was high (Cronbach’s alpha for men rating women, men rating men, women rating women, and women rating men were all >0.90). Participants also completed the TDDS (Table 1). Responses on the three TDDS subscales were scored following MK-2206 in vitro Tybur et al. (2009). Higher scores represent greater disgust sensitivity. The TDDS and face ratings were completed in a fully randomized order. Male and female faces were presented in separate, randomly ordered

blocks of trials in the face-rating task, and, within each block, trial order was fully randomized. The order of TDDS items was also fully randomized in the questionnaire block. As in previous research (Tybur, Bryan, Lieberman, Caldwell Hooper, & Merriman, 2011), women reported greater sexual (t(61) = 7.10, p < 0.001, d = 0.90) and pathogen (t(61) = 2.20, p = 0.032, d = 0.28) disgust than men. Women and men did not differ significantly in moral disgust (t(61) = −0.23,

p = 0.82, d = 0.03). Partners’ scores for sexual disgust were positively correlated (r = 0.38, N = 62, p = 0.002), but partners’ scores for pathogen (r = −0.01, N = 62, Selleck Veliparib p = 0.95) and moral (r < 0.01, N = 62, p > 0.99) disgust were not. For each participant, we first calculated the correlation between (1) their attractiveness rating for each of the 50 men’s faces and those 50 men’s rated facial adiposity (mean r = −0.14, SD = 0.14), (2) their attractiveness rating for each of the 50 men’s faces and those 50 men’s BMI (mean r = −0.09, SD = 0.14), (3) their attractiveness rating for each of the 50 women’s faces and those 50 women’s rated facial adiposity (mean r = −0.19, SD = 0.13), and (4) their

attractiveness rating for each of the 50 women’s faces and those 50 women’s BMI (mean r = −0.24, SD = 0.12). Note that this procedure produces four correlation coefficients for each participant (representing their preferences for perceived adiposity in male faces, cues of BMI in male faces, perceived adiposity in female faces, and cues of BMI in female faces, respectively). These preference scores (i.e., correlation BCKDHB coefficients) served as the dependent variables in subsequent analyses. For each of these preference scores, larger positive values indicate stronger preferences for facial cues of heavier weight and larger negative values indicate stronger preferences for facial cues of lower weight. In order to establish whether preferences for rated adiposity and preferences for cues of BMI measure similar constructs, we analyzed men’s and women’s preference scores for own-sex and opposite-sex faces using factor analysis.

Hyal are also present in almost all venoms, acting as

a “diffusion factor” by facilitating the penetration of the other harmful venom components and enhancing their action in various tissues into the bloodstream (Kemparaju and Girish, find more 2006; Senff-Ribeiro et al., 2008). Hyal have been described as “allergenic factors” in scorpion, bee, and wasp venoms, and are able to induce severe and fatal anaphylactic IgE-mediated reactions in humans (Lu et al., 1995; Kolarich et al., 2005). Hyal have already been characterized as glycoproteins (Kemeny et al., 1984; Jin et al., 2008) and analysis by high performance liquid chromatography and mass spectrometry revealed that the α-1,3-fucose-containing N-glycan is the fundamental structure responsible for their allergenicity (Kubelka Selleck XL184 et al., 1995; Kolarich and Altmann, 2000; Kolarich et al., 2005). Since allergenic Hyal are phylogenetically more

conserved among the other Hymenoptera allergens (e.g. Ag5 and PLA1), a significant degree of homology is observed among the sequences and 3D structures of these proteins, whether they are from different vespids or honeybee Apis mellifera venom (Api m 2) ( Jin et al., 2010). In addition, a large percentage of patients allergic to Hymenoptera venom show reactivity to both bee and wasp venoms (known as cross-reactivity) in tests for the presence of IgE-specific antibodies ( Hemmer, 2008). This makes selection of the most suitable venom for immunotherapy difficult. However, it is unclear whether this cross-reactivity is due to (a) sequence homology between these hyaluronidases; (b) sensitivity to the specific IgE antibodies; or (c) cross-reactive N-glycans (cross-reactive carbohydrate determinants [CCDs]), which have been investigated unless in allergens from different sources ( Jin et al., 2010; Eberlein et al., 2012; Al-Ghouleh et al.,

2012). In terms of the mechanism of action on the substrate, Hyal enzymes are classified into three types (Meyer, 1971): (a) the group of the endo-β-N-acetyl-d-hexosaminidases that hydrolize the high molecular weight substrate (HA) to tetrasaccharide as the main end product, being this group represented by the testicular enzyme; (b) the β-endoglucuronidases group represented by hyase from leeches and hookworm ( Hotez et al., 1994); (c) and finally the group of lyases that act via β-elimination, yielding disaccharides as the main end products represented by the bacterial hyases. According to Laurent (1989), Cramer et al. (1994) and Takagaki et al. (1994) the enzymes of the first group also catalyzes transglycosylation reactions, producing hexa-, di-, and octa-saccharides during hydrolysis of HA. Hyaluronate-4-glycanohydrolase (EC 3.2.1.35), or Hyal type 1, is an endo-β-N-acetyl-d-hexosaminidase is also found in Hymenoptera venoms and mammalian spermatozoa.