Different bacteria respond to AI-2 in different ways. Some, notablyVibrio sp., detect the presence of AI-2 using specific two component signal transduction to initiate a phospho-relay [17–19]. Others, likeSalmonellaandEscherichia colipossess ABC transporter proteins which import and modify AI-2 [16,20–22]. In each of these scenarios, the precise chemical nature of AI-2 appears to differ since the binding protein components have been shown to interact with different, but structurally related molecules. The LuxP AI-2 binding protein ofV. harveyiwas co-crystallized with a furanosyl-borate diester (3A-methyl-5,6-dihydro-furo(2,3-D)(1,3,2)dioxaborole-2,2,6,6A-tetraol;S-THMF-borate) GDC-0941 research buy [23], whilst LsrB ofS. entericiaserovar

Typhimurium was found in complex with (2R, 4S)-2-methyl-2,3,3,4-tetrahydroxytetrahydrofuran (R-THMF) [24]. Other cyclisation derivatives of DPD such as 4-hydroxy-5-methyl-3(2H)-furanone (MHF) or a furanosyl carbonate

diester [25] have also been shown to possess AI-2 activity [14,26]. The LuxS enzyme is an established part of the activated methyl cycle (AMC) that LY3023414 solubility dmso generatesS-adenosyl-L-methionine (SAM) the methyl donor for methylation of RNA, DNA, proteins and certain metabolites. In this cycle, SAM is first converted toS-adenosyl-L-homocysteine (SAH) which is then detoxified by the Pfs enzyme to generate adenine andS-ribosyl-L-homocyteine (SRH), the substrate of the LuxS enzyme. In the conversion of SRH to homocysteine, DPD is produced as a byproduct and derivatives of this with AI-2 activity are found in culture supernatants [14,26]. The homocysteine moiety is then converted to methionine and subsequently, SAM. Using AI-2 induced bioluminescence ofV. harveyias a reporter system, numerous species of bacteria have been shown to produce AI-2 activity includingHelicobacter pylori[27],E. coli and Salmonella buy MG-132 entericaserovar Typhimurium [22,28,29],Neisseria meningitidis[30–32],Haemophilus influenza[33]Clostridium difficile[34] andC. jejuni[35]. Many of the AI-2 producing bacteria studied are pathogens, and currently numerous reports concluding that LuxS and AI-2 contribute to novel signalling systems

exist, although critical evaluation of this data suggests that further studies are required to verify these observations [10,26,36–38]. The potential importance of LuxS in recycling intermediates in the activated methyl cycle via the conversion of SRH to homocysteine and then methionine should not be overlooked. Indeed the disruption ofluxSitself could decrease the virulence of a pathogen through metabolic perturbations without any involvement of AI-2 in cell-to-cell signalling. Support for this hypothesis comes from two recent studies inNeisseria meningitidiswhere evidence for a proteomic or transcriptional response to AI-2 was lacking [31,32], but the mutant was significantly attenuatedin vivo[30,39]. Discrimination between the two roles of LuxS/AI-2 is somewhat hazardous.

In a review of the literature concerning the efficacy of commercially available CE, Coombes and Hamilton [20] noted that studies supporting the use of CE for improved performance during prolonged endurance exercise frequently included participants exercising after a 12-h fast. Similar conditions were found for the majority of the ~ 1–h duration studies SC75741 datasheet cited above in which positive results were found for carbohydrate beverages [2, 4–9, 11–15, 17]. Of the 17 studies reviewed in this current paper, five [3, 6, 10, 16, 18] reported a benefit of CE use for subjects who were not fasted prior to exercise, and 1 of those investigations only included 5 moderately trained participants

[10]. Cyclists [21] and runners [22] who were fed before exercise failed to

show improved performance during 1-h time trials when consuming CE as compared to a sweetened placebo during exercise. Ingesting carbohydrate-rich gels with water before and during runs lasting 75 min also has also not proven effective in improving performance of fed runners [23]. Similarly, the ergogenic effect of a carbohydrate mouth rinse reported in the studies mentioned above has not been confirmed in fed runners [24] or cyclists [25]. Conflicting results and few investigations in which a pre-exercise meal was consumed make it difficult to extrapolate results to individuals who are fed prior to exercise. Given the preceding discussion, it remains unknown whether CE improves performance in recreational Emricasan research buy exercise bouts lasting ~ 1 h. Non-caloric electrolyte beverages (NCE), similar to the placebos prepared and used in the investigations cited above, may be an appealing alternative to water for exercisers concerned with caloric intake but who prefer flavored beverages over water, potentially increasing fluid intake during and after exercise [26]. However, it is unclear whether a NCE is as efficacious as a CE in improving or maintaining performance in recreational exercise bouts lasting ~ 1 h. Therefore, the purpose Florfenicol of this study was to determine if recreational exercisers, while in a post-prandial

state, would; a) exhibit improved performance in exercise lasting ~ 1 h in duration, b) perceive exercise as less difficult, or c) report lower levels of fatigue, when consuming a CE during exercise compared to a NCE or water (W). It was hypothesized that there would be no differences in performance, mood, or rate of perceived exertion among beverages. Methods Participants Men (n = 23) and women (n = 13) ages 19–30 who reported participating in a minimum of 150 but no more than 450 min of aerobic exercise per week for the previous 3 months volunteered to participate in this study. Thirteen of the thirty-six participants reported that they engaged in indoor or outdoor cycling (2.3 ± 1.4 times per week).

coli. The resulting plasmid (pCG132) was verified by sequencing and electroporated into S. aureus strain RN4220. Since pMUTIN4 does not have a gram-positive origin of replication,

all clones had gone through a single crossover event, which inserted the vector into the genome and placed the cap5A gene under the control of the IPTG-inducible Pspac promoter. The integrated plasmid was then transduced into strain Newman using Φ11 lysates. Mutants were verified by PCR using the oligonucleotides P5spac (TACATCCAGAACAACCTCTG) and capArev (GACTTTAACTGCTGTACCGTCTGCT) and PFGE. Extraction of capsular polysaccharides (CP) For extraction of crude capsule extract, staphylococci were plated onto Columbia blood agar plates that had been supplemented

with 50 mM NaCl. After 24 h of incubation at 37°C, the bacteria were harvested by suspension in PBS buffer. The CP was detached from the cells by autoclaving at 120°C for 1 h and the cell debris LCZ696 concentration was removed by centrifugation. The supernatant was passed through JNK-IN-8 price a cellulose acetate filter (pore size 0.45 μm). Cell wall teichoic acid was removed by treatment with 50 mM NaIO4 for 72 h at room temperature in the dark [39]. The crude extract was then washed with PBS buffer by ultrafiltration on a YM10 membrane (Millipore, Schwalbach, Germany) or employing Vivaspin 6 columns (exclusion volume of 3 kDa) (Sartorius, Göttingen Germany). These extracts were then added to MIC determinations in MH medium using S. aureus NCTC 8325 and S. aureus SG511 as indicator strains. In order to test for contaminating nucleic acids, the extracts were digested with DNase and RNAse [40] and tested again. Crude capsule extract from S. aureus NCTC 8325 which cannot produce a capsule because of the point mutation in Cap5E and PBS buffer served as negative controls in these experiments. Purified CP5 was obtained as described in [41]. Sequencing of the promoter region of the CP5 biosynthesis gene cluster A 735 bp DNA segment comprising the promoter region

of the CP5 biosynthesis gene cluster was amplified using a standard PCR protocol and the primer pair (AGCTCGCATTTGAAGATCAATGT) and (CCTCTTGTGCCATAAACTGAGG) (bp 166966–166988 and bp 167586–167607, NCBI: NC_002745). The product was purified (QIAquick Gel Extraction Protein tyrosine phosphatase Kit, Qiagen, Hilden, Germany) and sequenced (Sequiserve, Vaterstetten, Germany). Detection of the cap5 gene cluster in the VISA strains was performed using primers cap5-9864 (GTACGAAGCGTTTTGATAGTT) and cap5-9332 (GAAAGTGAACGATTAGTAGAA) that flank the type-specific sequences of cap5I and cap5J in S. aureus [42]. The insertion of IS256 in cap5A in S. aureus SA1450/94 was complemented by reconstituting cap5A on the plasmid pCapAre, exactly as described in [34]. The fragment was amplified employing genomic DNA of S. aureus SA137/93G as a template and the primers pCapAreconfor (GCAGAGCTCGCATTTGAA) and pCapAreconrev (CCAATGATTAAGCTTGATAGTCC).

The findings at operation included a 4 cm by 5 cm pericaecal abscess mass adjacent to the anterior tenia coli. Within the abscess mass was a perforated anterior caecal diverticulum with necrotic wall. There was a polypoid mass within the wall of the caecum. The appendix was macroscopically normal with no evidence of acute inflammation. There was a suspicion of a perforated caecal tumour. He then underwent a right hemicolectomy with an ileo-transverse anastomosis through a medial extension of the appendicectomy wound. The histology of the right hemicolectomy specimen macroscopically

showed an inflamed and perforated solitary caecal diverticulum with abscess formation and an isolated caecal pedunculated mTOR activity polyp. Microscopically no dysplasia or malignancy within the caecal diverticulum and the polyp was a tubulovillous adenoma with low grade dysplasia. The caecal diverticulum lacked mucularis propria and therefore was considered to be acquired [Figures 1 and 2]. Figure 1 Showing partially maintained diverticulum mucosal lining with erosion and loose granulation tissues with acutely inflamed serosa

and extramural fat (indicated with black arrow). Figure 2 The perforation of the diverticulum mucosal is extending into the extramural fat (indicated with black arrow). His postoperative course was uneventful and he was discharged home within a week of admission with an outpatient colonoscopy planned to evaluate the rest of his bowel. His follow up colonoscopy revealed further left sided colonic polyps with histology showing tubulovillous adenoma with moderate dysplasia. Discussion Tanespimycin Solitary caecal diverticulum is uncommon and the first description in literature was by Potier 3-mercaptopyruvate sulfurtransferase in 1912 [1, 3]. Several cases have been reported since its first description but its preoperative diagnosis continues to be very elusive. The reported frequency in literature has been estimated to be 1 in 300 appendicectomies

[4, 7]. It accounts for 3.6% of all colonic diverticula with median age incidence of 44 years and male to female ratio of 3:2 [8]. Caecal diverticulitis is a rare cause of right iliac fossa abdominal pain in Caucasian patients, but is rather more common amongst the Asian or Oriental populations [1, 2]. It usually presents in a manner similar to an acute appendicitis and the two are clearly indistinguishable except occasionally by imaging investigations but mostly at operation [3–5]. Lane et al [6] reported that more than 70% of patients with caecal diverticulitis were operated on with a presumptive preoperative diagnosis of acute appendicitis. Solitary caecal diverticulum has been classified into congenital (true) and acquired (false) groups. Congenital or true diverticulum contains all layers of the colonic wall and embryologically is thought to have arisen from a transient outpouching of the caecal wall at about 6 weeks of gestational age.

The purpose of the present study was to determine if this specific CYP1A2 polymorphism influences the ergogenic effect of caffeine supplementation in trained cyclists. Methods Subjects A total of 36 male recreationally competitive cyclists participated in the present study. One of these participants was excluded from the study

post-hoc, as their cycling performance differed by more than two standard deviations from the mean value of the group. Therefore, 35 cyclists (age = 25.0 ± 7.3 yrs, height = 178.2 ± 8.8 cm, weight = 74.3 ± 8.8 kg, VO2max = 59.35 ± 9.72 ml·kg-1·min-1) were used for data analysis. GDC-0449 chemical structure Written informed consent was obtained from all participants prior to participation and the study and consent form were approved by the James Madison University Institutional Review Board. Habitual caffeine intake

was self-reported by participants. Briefly, participants were asked for their average weekly intake of coffee, tea, soda, chocolate, and other caffeinated beverages. Typical milligram doses [14] were assigned to each and an approximate daily intake was obtained. Based on previous criteria [15], participants were then characterized as having low (0-150 mg·day-1), moderate CX-5461 datasheet (151-300 mg·day-1) and high (> 300 mg·day-1) caffeine intake. Maximal exercise test Cyclists began the test at a work rate of 150 W on an electrically braked cycle ergometer, with load increases of 20 W each minute until volitional exhaustion. Maximal oxygen uptake (VO2max) was defined as the highest 1-minute oxygen value obtained during the test. Oxygen uptake (VO2) was monitored continuously via a Sensormedics Vmax (Yorba Linda, CA) metabolic measurement system calibrated in advance

of all tests. Heart rate was monitored throughout the test using a Polar Heart Rate Monitor (Lake Success, NY). 40-kilometer time trial Time trials were performed on two separate occasions. Protein kinase N1 All testing was done in the morning following a 12-hour fast and at least 24 hours after any caffeine ingestion. Subjects were instructed to maintain their training and not increase or decrease their volume or intensity over the course of the study. One hour prior to testing, cyclists ingested capsules containing either 6 mg of anhydrous caffeine per kilogram body weight or white flour (placebo) randomly administered in double-blind fashion. Time trials were performed on an indoor cycle trainer (Velotron; Racermate, Seattle, WA) on a computer-simulated course. The course consisted of eight laps of a flat, five-kilometer loop. Cyclists were free to self-select the resistance by changing gears during the test and were allowed to track distance completed on the course via a video display. However, they were blinded to their time, speed, and power output during the trials. Water was available for the cyclists to ingest ad libitum.

Cell 124:263–266PubMedCrossRef

72. Tan TT, Coussens LM (2007) Humoral immunity, inflammation and cancer. Curr Opin Immunol 19:209–216PubMedCrossRef 73. Witz IP (2008) Yin-yang activities and vicious cycles in the tumor microenvironment. Cancer Res 68:9–13PubMedCrossRef 74. Mantovani A, Bottazzi B, Colotta F et al (1992) The origin and function of tumor-associated AUY-922 datasheet macrophages. Immunol Today 13:265–270PubMedCrossRef 75. Brigati C, Noonan DM, Albini A et al (2002) Tumors and inflammatory infiltrates: Friends or foes? Clin Exp Metastasis 19:247–258PubMedCrossRef 76. Dirkx AE, Oude Egbrink MG, Wagstaff J et al (2006) Monocyte/macrophage infiltration in tumors: Modulators of angiogenesis. J Leukoc Biol 80:1183–1196PubMedCrossRef 77. Lamagna C, Aurrand-Lions M, Imhof BA (2006)

Dual role of macrophages in tumor growth and angiogenesis. J Leukoc Biol 80:705–713PubMedCrossRef 78. Talmadge JE, Donkor M, Scholar E (2007) Inflammatory cell selleck infiltration of tumors: Jekyll or Hyde. Cancer Metastasis Rev 26:373–400PubMedCrossRef 79. Whitworth PW, Pak CC, Esgro J et al (1990) Macrophages and cancer. Cancer Metastasis Rev 8:319–351PubMedCrossRef 80. Pak CC, Fidler IJ (1991) Molecular mechanisms for activated macrophage recognition of tumor cells. Semin Cancer Biol 2:189–195PubMed 81. Lin EY, Pollard JW (2004) Role of infiltrated leucocytes in tumour growth and spread. Br J Cancer 90:2053–2058PubMedCrossRef PIK3C2G 82. Pollard JW (2004) Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 4:71–78PubMedCrossRef 83. Mantovani A, Schioppa T, Porta C et al (2006) Role of tumor-associated macrophages in tumor progression and invasion. Cancer Metastasis Rev 25:315–322PubMedCrossRef 84. Pawelek J, Chakraborty A, Lazova R et al (2006) Co-opting macrophage

traits in cancer progression: A consequence of tumor cell fusion? Contrib Microbiol 13:138–155PubMedCrossRef 85. Allavena P, Sica A, Solinas G et al (2008) The inflammatory micro-environment in tumor progression: The role of tumor-associated macrophages. Crit Rev Oncol Hematol 66:1–9PubMedCrossRef 86. Gazzaniga S, Bravo AI, Guglielmotti A et al (2007) Targeting tumor-associated macrophages and inhibition of MCP-1 reduce angiogenesis and tumor growth in a human melanoma xenograft. J Invest Dermatol 127:2031–2041PubMedCrossRef 87. Schwantke N, Le Bouffant F, Dorée M et al (1985) Protein kinase C: properties and possible role in cellular division and differentiation. Biochimie 67:1103–1110PubMedCrossRef 88. Cohen I, Van der Kloot W (1985) Calcium and transmitter release. Int Rev Neurobiol 27:299–336PubMedCrossRef 89. Stryer L, Bourne HR (1986) G proteins: a family of signal transducers. Annu Rev Cell Biol 2:391–419PubMedCrossRef 90. Bregman MD, Sipes NJ (1986) Transformation-related growth factors and their receptors. Int J Cell Cloning 4:224–236PubMedCrossRef 91.

J Clin Microbiol 2006, 44:2626–2629.CrossRefPubMed 62. Vial PA, Mathewson JJ, Guers L, Levine MM, DuPont HL: Comparison of two assay

methods for patterns of adherence to HEp-2 cells of Escherichia coli from patients with diarrhea. J Clin Microbiol 1990, 28:882–885.PubMed 63. Iida K, Mizunoe Y, Wai SN, Yoshida S: Type 1 fimbriation and its phase switching in diarrheagenic Escherichia coli strains. Clin Diagn Lab Immunol 2001, Selleck FK228 8:489–495.PubMed Authors’ contributions SMT and MT contributed to the design of the study, performed the PCR and assays and contributed to the preparation of the manuscript. KA, AB and VBW performed the hybridisation, haemagglutination and tissue culture assays and contributed to the preparation of the manuscript. WQ and TSW interpreted the raw MSLT data and contributed to the preparation of the manuscript. RMRB conceived and designed the study and oversaw the preparation of the manuscript. All authors read and approved

the final manuscript.”
“Background I-BET151 price Under normal conditions, the lower female genital tract harbours a mutualistic microflora that primarily consists of lactobacilli which confer antimicrobial protection to the vagina as a critical port of entry for local, ascending and systemic infectious disease [1, 2]. The lactobacilli-driven defence of the vaginal niche is in its essence seized as a principle of colonisation resistance, i.e. the vaginal lactobacilli prevent colonisation of the vaginal epithelium by other microorganisms, through a variety of mechanisms [3]. Despite their intrinsic antimicrobial potential however, vaginal lactobacilli fail to retain dominance in a considerable number of women, resulting in overgrowth Cediranib (AZD2171) of the vaginal epithelium by other bacteria, as observed, most typically, with anaerobic

polymicrobial overgrowth in bacterial vaginosis [1], or less commonly, with overgrowth by streptococci, including group A [4] and group B streptococci [5, 6], by bifidobacteria [7, 8], or by coliforms such as E. coli [5, 6, 9]. Loss of the indigenous lactobacilli strongly predisposes to ascending genital tract infection, which in pregnancy is a major cause of chorioamnionitis, amniotic fluid infection, and preterm birth [1, 2]. A depletion of the vaginal Lactobacillus microflora further predisposes to the acquisition of sexually transmitted infectious diseases such as gonorrhoea [10, 11], chlamydiosis [11], and HIV infection [12, 13]. The mechanisms involved in the loss of the mutualistic lactobacilli remain largely unknown and hence it remains elusive whether lactobacilli for some reason are losing ground thereby allowing other microorganisms to proliferate or whether other bacteria for some reason elicit overgrowth thereby displacing the resident lactobacilli.

The growth medium

can also have an effect on the utilization of substrates and brucellae may operate with alternate metabolic pathways leading to discrepant stimulatory effects in different assays [30]. Therefore, a minimal medium i.e. buffered sodium chloride peptone (from potatoes) solution was used in Taxa Profile™ and Micronaut™ plates this website to avoid interference with other potential substrates in the culture medium. The rates of oxidation of various compounds are also strongly dependent on intact bacterial membranes and pH values [33, 34]. In our experiments, asparagines were easily oxidized by most of the Brucella spp., but aspartic acid was not (exceptions were B. suis bv 4, B. microti, and B. inopinata).

buy CB-5083 Furthermore, glutamic acid was oxidized, but intermediates in the pathway, such as α-ketoglutarate and succinate (except for B. microti and B. inopinata) were usually not. Lowering the pH of a reaction mixture containing intact cells of brucellae markedly increased the oxidation rate of these metabolites e.g. L-aspartate, α-ketoglutarate, succinate, fumarate, L-malate, oxaloacetate, pyruvate and acetate [34]. Differences between Brucella species may occur in the pH range at which the bacteria are able to utilize some of the substrates and therefore labile metabolic profiles can be observed [35]. Nevertheless, such reactions may be helpful for the differentiation of species and biovars if assay conditions are stable. The effect of extracellular adjustment of the pH upon intracellular enzymatic reactions can be explained by organic

acids permeating the cell more readily when undissociated than when Thalidomide ionized. Hence, a pH change may overcome the permeability barrier for many substrates especially of the Krebs’ cycle. For this reason our results do not easily reflect intracellular substrate utilization. In proteomic studies on intracellular brucellae and bacteria grown under stress conditions comparable to the intracellular niche of Brucella, enzymes of the TCA cycle i.e. the succinyl CoA synthetase and aconitate hydratase were found increased [36, 37]. In contrast, intermediates of the TCA cycle such as citrate, isocitrate, α-ketoglutarate, succinate, malate, fumarate were not generally metabolized in vitro or showed variable metabolization in the different species such as oxaloacetic acid. Although modelling of the intracellular niche of brucellae is not a topic of this study the Micronaut™ system might be helpful to investigate differences in the metabolic activity between the species under various growth conditions.

A pilot study including conventionally reared, germ free and SCID mice demonstrated that commensal microbial colonization influences CH5424802 solubility dmso the expression of innate host defense mediators at both the mRNA and the protein level in the periodontal tissues [17]. In a non-oral setting, a number of studies have examined the transcriptional profiles in response to

microbial stimuli in intestinal [18–22], gastric [23] and corneal epithelia [24]. In this publication, we expand our earlier work and investigate the association between the subgingival bacterial profile of the periodontal pocket and the whole genome transcriptome of the gingival tissue that is in intimate contact with the microbial biofilm. Methods The study design was approved by the Institutional Review Board of the Columbia University Medical Center. Subjects 120 subjects with moderate to severe periodontitis [65 (54.2%) with chronic

and 55 with aggressive periodontitis] were recruited among those referred to the Post-doctoral Periodontics Clinic of the Columbia University College of Dental Medicine. Eligible patients were (i) >13 yrs old; (ii) had ≥24 teeth; (iii) had no history of systematic periodontal therapy other than occasional prophylaxis, (iv) had received no systemic antibiotics or anti-inflammatory drugs for ≥6 months, (v) harbored selleck inhibitor ≥4 teeth with radiographic bone loss, (vi) did not have diabetes or any systemic condition that entails a diagnosis of “”Periodontitis as a manifestation of systemic diseases”" [25], (vii) were not pregnant, and (ix) were not current users of tobacco products or nicotine replacement medication. Signed informed consent 4��8C was obtained prior to enrollment. Clinical

examination All participants underwent a full-mouth examination of the periodontal tissues at six sites per tooth by a single, calibrated examiner. Variables recorded included presence/absence of visible dental plaque (PL), presence/absence of bleeding on probing (BoP), probing depth (PD), and attachment level (AL). Data were entered chair-side to a computer and stored at a central server. Gingival tissue donor areas and tissue sample collection Subsequently to clinical data entry, a specially developed software identified periodontally ‘diseased’ and ‘healthy’ tooth sites based on the clinical data. ‘Diseased’ sites showed BoP, had interproximal PD ≥4 mm, and concomitant AL ≥3 mm. ‘Healthy’ sites showed no BoP, had PD ≤4 mm and AL ≤2 mm. Next, the software identified (i) maxillary ‘diseased’ and ‘healthy’ interdental papillae, based on the above criteria, and (ii) pairs of diseased interdental papillae with similar clinical presentation (PD and AL within 2 mm of each other). A posterior maxillary sextant encompassing a pair of qualifying ‘diseased’ interdental papillae was identified.

Infect Immun 2002,70(5):2256–2263.PubMedCrossRef 8. Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK, Sherman DR: Rv3133c/dosR is a transcription factor that mediates the hypoxic

response of Mycobacterium tuberculosis . Mol Microbiol 2003,48(3):833–843.PubMedCrossRef 9. Parish T, Smith DA, Kendall S, Casali N, Bancroft GJ, Stoker NG: Deletion of two-component regulatory systems increases the virulence of Mycobacterium tuberculosis . Infect Immun 2003,71(3):1134–1140.PubMedCrossRef 10. Via LE, Curcic R, Mudd MH, Dhandayuthapani S, Ulmer RJ, Deretic V: Elements of signal transduction in Mycobacterium mTOR activation tuberculosis : in vitro phosphorylation click here and in vivo expression of the response regulator MtrA. J Bacteriol 1996,178(11):3314–3321.PubMed

11. Zahrt TC, Deretic V: An essential two-component signal transduction system in Mycobacterium tuberculosis . J Bacteriol 2000,182(13):3832–3838.PubMedCrossRef 12. Fol M, Chauhan A, Nair NK, Maloney E, Moomey M, Jagannath C, Madiraju MV, Rajagopalan M: Modulation of Mycobacterium tuberculosis proliferation by MtrA, an essential two-component response regulator. Mol Microbiol 2006,60(3):643–657.PubMedCrossRef 13. Rajagopalan M, Dziedzic R, Al Zayer M, Stankowska D, Ouimet MC, Bastedo DP, Marczynski GT, Madiraju MV: The Mycobacterium tuberculosis origin of replication and the promoter PFKL for immunodominant secreted antigen 85B are the targets of MtrA, the essential response

regulator. J Biol Chem 2010,285(21):15816–15827.PubMedCrossRef 14. Cangelosi GA, Do JS, Freeman R, Bennett JG, Semret M, Behr MA: The two-component regulatory system mtrAB is required for morphotypic multidrug resistance in Mycobacterium avium . Antimicrob Agents Chemother 2006,50(2):461–468.PubMedCrossRef 15. Möker N, Brocker M, Schaffer S, Krämer R, Morbach S, Bott M: Deletion of the genes encoding the MtrA-MtrB two-component system of Corynebacterium glutamicum has a strong influence on cell morphology, antibiotics susceptibility and expression of genes involved in osmoprotection. Mol Microbiol 2004,54(2):420–438.PubMedCrossRef 16. Crooks GE, Hon G, Chandonia JM, Brenner SE: WebLogo: A sequence logo generator. Genome Res 2004,14(6):1188–1190.PubMedCrossRef 17. Blokpoel MC, Murphy HN, O’Toole R, Wiles S, Runn ES, Stewart GR, Young DB, Robertson BD: Tetracycline-inducible gene regulation in mycobacteria. Nucleic Acids Res 2005,33(2):e22.PubMedCrossRef 18. Salazar L, Guerrero E, Casart Y, Turcios L, Bartoli F: Transcription analysis of the dnaA gene and oriC region of the chromosome of Mycobacterium smegmatis and Mycobacterium bovis BCG, and its regulation by the DnaA protein. Microbiology 2003,149(Pt 3):773–784.PubMedCrossRef 19.